Transcript: Human XR_930469.2

PREDICTED: Homo sapiens lysozyme like 2 (LYZL2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LYZL2 (119180)
Length:
685
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_930469.2
NBCI Gene record:
LYZL2 (119180)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_930469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154337 CTACGGCATCTTCCAGATCAA pLKO.1 407 3UTR 100% 4.950 2.970 N LYZL2 n/a
2 TRCN0000152708 GTATTATGAGAGCGGCTACAA pLKO.1 347 3UTR 100% 4.950 2.970 N LYZL2 n/a
3 TRCN0000378909 ATTATGAGAGCGGCTACAACA pLKO_005 349 3UTR 100% 4.950 2.475 Y LYZL1 n/a
4 TRCN0000049549 CGGAAAGCTGAAGGAGAACAA pLKO.1 449 3UTR 100% 4.950 2.475 Y LYZL1 n/a
5 TRCN0000156017 CGGAAAGCTGAAGGAGAACAA pLKO.1 449 3UTR 100% 4.950 2.475 Y LYZL2 n/a
6 TRCN0000153636 CATCTTCCAGATCAACAGCTT pLKO.1 413 3UTR 100% 2.640 1.320 Y LYZL2 n/a
7 TRCN0000049548 CCTTGGAAACTGGATCTGCAT pLKO.1 323 3UTR 100% 2.640 1.320 Y LYZL1 n/a
8 TRCN0000154336 CCTTGGAAACTGGATCTGCAT pLKO.1 323 3UTR 100% 2.640 1.320 Y LYZL2 n/a
9 TRCN0000155683 CTTCAGCCTTGGAAACTGGAT pLKO.1 317 3UTR 100% 2.640 1.320 Y LYZL2 n/a
10 TRCN0000049550 GCGGGCATTCTGACCCTCATT pLKO.1 204 3UTR 100% 1.650 0.825 Y LYZL1 n/a
11 TRCN0000372954 ATGACGGCAGCATCGACTATG pLKO_005 391 3UTR 100% 10.800 5.400 Y LYZL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_930469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09459 pDONR223 100% 74.5% None (many diffs) n/a
2 ccsbBroad304_09459 pLX_304 0% 74.5% V5 (many diffs) n/a
3 TRCN0000481443 ACTATCGTGGTCGGAACCGGTAAA pLX_317 72.4% 74.5% V5 (many diffs) n/a
4 ccsbBroadEn_09203 pDONR223 100% 73% None (many diffs) n/a
5 ccsbBroad304_09203 pLX_304 0% 73% V5 (many diffs) n/a
6 TRCN0000473283 TGGGTATCGATTTTTACGGAAGGC pLX_317 19.2% 72% V5 (many diffs) n/a
Download CSV