Transcript: Human XM_017016791.1

PREDICTED: Homo sapiens lysozyme like 1 (LYZL1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LYZL1 (84569)
Length:
677
CDS:
52..549

Additional Resources:

NCBI RefSeq record:
XM_017016791.1
NBCI Gene record:
LYZL1 (84569)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372954 ATGACGGCAGCATCGACTATG pLKO_005 386 CDS 100% 10.800 5.400 Y LYZL1 n/a
2 TRCN0000378909 ATTATGAGAGCGGCTACAACA pLKO_005 344 CDS 100% 4.950 2.475 Y LYZL1 n/a
3 TRCN0000049549 CGGAAAGCTGAAGGAGAACAA pLKO.1 444 CDS 100% 4.950 2.475 Y LYZL1 n/a
4 TRCN0000156017 CGGAAAGCTGAAGGAGAACAA pLKO.1 444 CDS 100% 4.950 2.475 Y LYZL2 n/a
5 TRCN0000153636 CATCTTCCAGATCAACAGCTT pLKO.1 408 CDS 100% 2.640 1.320 Y LYZL2 n/a
6 TRCN0000049548 CCTTGGAAACTGGATCTGCAT pLKO.1 318 CDS 100% 2.640 1.320 Y LYZL1 n/a
7 TRCN0000154336 CCTTGGAAACTGGATCTGCAT pLKO.1 318 CDS 100% 2.640 1.320 Y LYZL2 n/a
8 TRCN0000155683 CTTCAGCCTTGGAAACTGGAT pLKO.1 312 CDS 100% 2.640 1.320 Y LYZL2 n/a
9 TRCN0000049550 GCGGGCATTCTGACCCTCATT pLKO.1 199 CDS 100% 1.650 0.825 Y LYZL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09203 pDONR223 100% 82.3% 70.7% None (many diffs) n/a
2 ccsbBroad304_09203 pLX_304 0% 82.3% 70.7% V5 (many diffs) n/a
3 TRCN0000473283 TGGGTATCGATTTTTACGGAAGGC pLX_317 19.2% 81.3% 70.7% V5 (many diffs) n/a
4 ccsbBroadEn_09459 pDONR223 100% 78.6% 71.2% None (many diffs) n/a
5 ccsbBroad304_09459 pLX_304 0% 78.6% 71.2% V5 (many diffs) n/a
6 TRCN0000481443 ACTATCGTGGTCGGAACCGGTAAA pLX_317 72.4% 78.6% 71.2% V5 (many diffs) n/a
Download CSV