Construct: ORF TRCN0000473323
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014551.1_s317c1
- Derived from:
- ccsbBroadEn_04505
- DNA Barcode:
- TAGAGGCGTACTTAGTCACGGCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNH7 (90134)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473323
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 90134 | KCNH7 | potassium voltage-gated cha... | NM_173162.3 | 100% | 100% | |
2 | human | 90134 | KCNH7 | potassium voltage-gated cha... | XM_017005221.2 | 86.4% | 86.2% | (many diffs) |
3 | human | 90134 | KCNH7 | potassium voltage-gated cha... | XM_017005220.2 | 60.7% | 60.3% | (many diffs) |
4 | human | 90134 | KCNH7 | potassium voltage-gated cha... | XM_017005219.2 | 60.4% | 60% | (many diffs) |
5 | human | 90134 | KCNH7 | potassium voltage-gated cha... | NM_033272.4 | 60.3% | 59.9% | (many diffs) |
6 | human | 90134 | KCNH7 | potassium voltage-gated cha... | XM_017005218.2 | 60% | 59.6% | (many diffs) |
7 | human | 90134 | KCNH7 | potassium voltage-gated cha... | XM_011512109.3 | 60% | 59.5% | (many diffs) |
8 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XM_006498828.1 | 90.2% | 96.9% | (many diffs) |
9 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XM_017315936.1 | 88.5% | 95.2% | (many diffs) |
10 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XM_006498826.1 | 87.7% | 93.7% | (many diffs) |
11 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XM_006498827.1 | 87.5% | 94.2% | (many diffs) |
12 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XR_001781102.1 | 74.2% | (many diffs) | |
13 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XR_374421.1 | 73.8% | (many diffs) | |
14 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XR_374422.2 | 73.3% | (many diffs) | |
15 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XM_017315932.1 | 64.7% | 69% | (many diffs) |
16 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XM_011239315.2 | 55.5% | 59.2% | (many diffs) |
17 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | NM_133207.2 | 55.3% | 59.1% | (many diffs) |
18 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XM_011239314.2 | 55.2% | 58.8% | (many diffs) |
19 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XM_011239313.2 | 54.9% | 58.7% | (many diffs) |
20 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XM_006498825.2 | 54.8% | 58.8% | (many diffs) |
21 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XR_374420.1 | 54% | (many diffs) | |
22 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XM_017315931.1 | 43.9% | 46.6% | (many diffs) |
23 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XM_011239316.2 | 28.5% | 29.1% | (many diffs) |
24 | mouse | 170738 | Kcnh7 | potassium voltage-gated cha... | XM_011239317.2 | 17.4% | 17% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2262
- ORF length:
- 2196
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc tgtgcgcagg gggcatgtgg caccacaaaa tacatttctg gggaccatca 121 ttcggaaatt tgaagggcaa aataaaaaat ttatcattgc aaatgccaga gtgcagaact 181 gtgccatcat ttattgcaac gatgggttct gtgagatgac tggtttctcc aggccagatg 241 tcatgcaaaa gccatgcacc tgcgactttc tccatggacc cgagaccaag aggcatgata 301 ttgcccaaat tgcccaggca ttgctggggt cagaagagag gaaagtggag gtcacctact 361 atcacaaaaa tgggtccact tttatttgta acactcacat aattccagtg aaaaaccaag 421 agggcgtggc tatgatgttc atcattaatt ttgaatatgt gacggataat gaaaacgctg 481 ccaccccaga gagggtaaac ccaatattac caatcaaaac tgtaaaccgg aaattttttg 541 ggttcaaatt ccctggtctg agagttctca cttacagaaa gcagtcctta ccacaagaag 601 accccgatgt ggtggtcatc gattcatcta aacacagtga tgattcagta gccatgaagc 661 attttaagtc tcctacaaaa gaaagctgca gcccctctga agcagatgac acaaaagctt 721 tgatacagcc cagcaaatgt tctcccttgg tgaatatatc cggacctctt gaccattcct 781 ctcccaaaag gcaatgggac cgactctacc ctgacatgct gcagtcaagt tcccagctgt 841 cccattccag atcaagggaa agcttatgta gtatacggag agcatcttcg gtccatgata 901 tagaaggatt cggcgtccac cccaagaaca tatttagaga ccgacatgcc agcgaagggc 961 cttttaatca tatcaagtca agcctcctgg gatccacatc agattcaaac ctcaacaaat 1021 acagcaccat taacaagatt ccacagctca ctctgaattt ttcagaggtc aaaactgaga 1081 aaaagaattc atcacctcct tcttcagata aaaccattat tgcacccaag gttaaagatc 1141 gaacacacaa tgtgactgag aaagtgaccc aggttctctc tttaggagca gatgtcctac 1201 ctgaatacaa actgcagaca ccacgcatca acaagtttac gatattgcac tacagccctt 1261 tcaaggcagt ctgggactgg cttatcctgc tgttggtcat atacactgct atatttactc 1321 cctactctgc agccttcctc ctcaatgaca gagaagaaca gaaaagacga gaatgtggct 1381 attcttgtag ccctttgaat gtggtagact tgattgtgga tattatgttt atcatagata 1441 ttttaataaa cttcagaaca acatatgtaa atcagaatga agaagtggta agtgatcccg 1501 ccaaaatagc aatacactac ttcaaaggct ggttcctgat tgacatggtt gcagcaattc 1561 cttttgactt gctgattttt ggatcaggtt ctgatgagac aacaacatta attggtcttt 1621 tgaagactgc ccgactcctc cgtcttgtgc gcgtggccag gaaactggat cgatattcag 1681 aatatggcgc tgctgttcta atgctcttaa tgtgcatctt tgccctgatt gctcactggc 1741 tggcttgcat ttggtatgcg attgggaatg tagaaaggcc ttacctgact gacaaaaTCG 1801 GATGGTTGGA TTCCTTAGGA CAGCAAATTG GGAAACGTTA CAATGACAGT GACTCAAGTT 1861 CTGGACCATC CATTAAAGAC AAATACGTCA CAGCACTTTA TTTTACCTTC AGCAGTTTAA 1921 CCAGTGTAGG ATTCGGGAAT GTGTCTCCTA ACACGAATTC GGAGAAAATC TTTTCAATTT 1981 GTGTCATGTT GATTGGCTCA CTAATGTATG CAAGCATTTT TGGGAATGTA TCTGCAATTA 2041 TCCAAAGACT ATACTCGGGA ACTGCCAGGT ACCACATGCA GATGCTGCGA GTAAAAGAGT 2101 TCATTCGCTT TCACCAAATC CCCAACCCTC TGAGGCAACG TCTTGAAGAA TATTTCCAGC 2161 ACGCATGGAC TTACACCAAT GGCATTGACA TGAACATGGT ATGTATGTCT GTTTTCCAAA 2221 ATGAAAGTGC CGCAGGCATT ATAGTGATAG CCAAAATGGA ATACCCAACT TTCTTGTACA 2281 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 2341 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 2401 AGGACGATAG AGGCGTACTT AGTCACGGCC GACGCGTTAA GTCgacaatc aacctctgga 2461 ttacaaaatt tgtgaaagat t