Transcript: Mouse XM_017315932.1

PREDICTED: Mus musculus potassium voltage-gated channel, subfamily H (eag-related), member 7 (Kcnh7), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnh7 (170738)
Length:
3171
CDS:
94..3156

Additional Resources:

NCBI RefSeq record:
XM_017315932.1
NBCI Gene record:
Kcnh7 (170738)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412860 AGACTTGATTGTGGATATTAT pLKO_005 1479 CDS 100% 15.000 21.000 N Kcnh7 n/a
2 TRCN0000423189 AGTTCTGGACCGTCCATTAAA pLKO_005 1930 CDS 100% 15.000 21.000 N Kcnh7 n/a
3 TRCN0000437211 GAGAGGGTCAACCCGATATTA pLKO_005 517 CDS 100% 15.000 21.000 N Kcnh7 n/a
4 TRCN0000430100 GGGAACGTTTCTGCAATTATT pLKO_005 2095 CDS 100% 15.000 21.000 N Kcnh7 n/a
5 TRCN0000437481 ACCCGGATGTGGTAGTTATTG pLKO_005 629 CDS 100% 13.200 18.480 N Kcnh7 n/a
6 TRCN0000068449 CCCAAGAACATATTTAGAGAT pLKO.1 949 CDS 100% 4.950 3.465 N Kcnh7 n/a
7 TRCN0000021346 CCCTTTGAATGTGGTAGACTT pLKO.1 1464 CDS 100% 4.950 3.465 N KCNH7 n/a
8 TRCN0000068448 CCTCCATTGATGATGAGCAAA pLKO.1 2933 CDS 100% 4.950 3.465 N Kcnh7 n/a
9 TRCN0000068452 CCTGCATCTGAACCAGACTTT pLKO.1 2316 CDS 100% 4.950 3.465 N Kcnh7 n/a
10 TRCN0000068451 CGGAAATTTGAAGGGCAGAAT pLKO.1 151 CDS 100% 4.950 3.465 N Kcnh7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04505 pDONR223 100% 64.7% 69% None (many diffs) n/a
2 ccsbBroad304_04505 pLX_304 0% 64.7% 69% V5 (many diffs) n/a
3 TRCN0000473323 TAGAGGCGTACTTAGTCACGGCCG pLX_317 21.4% 64.7% 69% V5 (many diffs) n/a
Download CSV