Transcript: Human XM_017005219.2

PREDICTED: Homo sapiens potassium voltage-gated channel subfamily H member 7 (KCNH7), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNH7 (90134)
Length:
3901
CDS:
300..3881

Additional Resources:

NCBI RefSeq record:
XM_017005219.2
NBCI Gene record:
KCNH7 (90134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414923 AGTTCTGGACCATCCATTAAA pLKO_005 2112 CDS 100% 15.000 12.000 N KCNH7 n/a
2 TRCN0000419084 TTGAATATGTGACGGATAATG pLKO_005 685 CDS 100% 13.200 10.560 N KCNH7 n/a
3 TRCN0000021344 CGGTCCATGATATAGAAGGAT pLKO.1 1123 CDS 100% 3.000 2.400 N KCNH7 n/a
4 TRCN0000412860 AGACTTGATTGTGGATATTAT pLKO_005 1661 CDS 100% 15.000 10.500 N Kcnh7 n/a
5 TRCN0000431613 GAGAGGGTAAACCCAATATTA pLKO_005 723 CDS 100% 15.000 10.500 N KCNH7 n/a
6 TRCN0000427779 GGGACCATCATTCGGAAATTT pLKO_005 345 CDS 100% 15.000 10.500 N KCNH7 n/a
7 TRCN0000425717 CATCAACAAGTTTACGATATT pLKO_005 1481 CDS 100% 13.200 9.240 N KCNH7 n/a
8 TRCN0000021345 CCTCCATTGATGATGAACAAA pLKO.1 3106 CDS 100% 5.625 3.938 N KCNH7 n/a
9 TRCN0000021346 CCCTTTGAATGTGGTAGACTT pLKO.1 1646 CDS 100% 4.950 3.465 N KCNH7 n/a
10 TRCN0000021348 CCTCTGAAGCAGATGACACAA pLKO.1 928 CDS 100% 4.950 3.465 N KCNH7 n/a
11 TRCN0000021347 CCTGAATTTCTAGACCTTGAA pLKO.1 3618 CDS 100% 4.950 3.465 N KCNH7 n/a
12 TRCN0000068449 CCCAAGAACATATTTAGAGAT pLKO.1 1155 CDS 100% 4.950 3.465 N Kcnh7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04505 pDONR223 100% 60.4% 60% None (many diffs) n/a
2 ccsbBroad304_04505 pLX_304 0% 60.4% 60% V5 (many diffs) n/a
3 TRCN0000473323 TAGAGGCGTACTTAGTCACGGCCG pLX_317 21.4% 60.4% 60% V5 (many diffs) n/a
Download CSV