Transcript: Mouse XM_006519045.2

PREDICTED: Mus musculus Rho guanine nucleotide exchange factor (GEF) 40 (Arhgef40), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgef40 (268739)
Length:
5481
CDS:
308..4882

Additional Resources:

NCBI RefSeq record:
XM_006519045.2
NBCI Gene record:
Arhgef40 (268739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121410 GCGTCTAGTGTCTGAACTGAT pLKO.1 3562 CDS 100% 4.950 6.930 N Arhgef40 n/a
2 TRCN0000121408 GCTCTTATTCAGCAAGCTCAA pLKO.1 4192 CDS 100% 4.050 3.240 N Arhgef40 n/a
3 TRCN0000121407 GCCCTGTTCAATTGCCTTTAT pLKO.1 5204 3UTR 100% 13.200 9.240 N Arhgef40 n/a
4 TRCN0000121409 CCAAGTACATTGCCTCCAGAA pLKO.1 899 CDS 100% 4.050 2.430 N Arhgef40 n/a
5 TRCN0000121411 CTTCGTTTACAAGCAGGCTTT pLKO.1 4237 CDS 100% 4.050 2.430 N Arhgef40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12256 pDONR223 100% 19.1% 20.1% None (many diffs) n/a
2 ccsbBroad304_12256 pLX_304 0% 19.1% 20.1% V5 (many diffs) n/a
3 TRCN0000473647 CTTTGCAATACGACTTCTAGGTGT pLX_317 45.4% 19.1% 20.1% V5 (many diffs) n/a
4 ccsbBroadEn_12257 pDONR223 98.6% 19.1% 20% None (many diffs) n/a
5 ccsbBroad304_12257 pLX_304 0% 19.1% 20% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV