Construct: ORF TRCN0000473989
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001687.1_s317c1
- Derived from:
- ccsbBroadEn_13938
- DNA Barcode:
- GGTTCGATCACGAGGTTACCACGA
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAB6A (5870)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473989
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5870 | RAB6A | RAB6A, member RAS oncogene ... | NM_002869.5 | 99.8% | 99.5% | 620delC |
| 2 | human | 5870 | RAB6A | RAB6A, member RAS oncogene ... | NM_198896.2 | 95% | 98% | (many diffs) |
| 3 | human | 5870 | RAB6A | RAB6A, member RAS oncogene ... | NM_001243719.1 | 83.9% | 83.6% | 0_1ins99;521delC |
| 4 | human | 150786 | RAB6D | RAB6D, member RAS oncogene ... | NM_001077637.1 | 78.8% | 74.8% | (many diffs) |
| 5 | human | 84084 | RAB6C | RAB6C, member RAS oncogene ... | NM_032144.3 | 78.7% | 74.4% | (many diffs) |
| 6 | human | 5870 | RAB6A | RAB6A, member RAS oncogene ... | NM_001243718.2 | 49.8% | 49.5% | 183_184ins312;308delC |
| 7 | mouse | 19346 | Rab6a | RAB6A, member RAS oncogene ... | NM_001163663.1 | 95.1% | 98.5% | (many diffs) |
| 8 | mouse | 19346 | Rab6a | RAB6A, member RAS oncogene ... | NM_024287.4 | 90.5% | 97.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 690
- ORF length:
- 624
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cacgggcgga gacttcggga atccgctgag gaaattcaag ctggtgttcc 121 tgggggagca aagcgttgga aagacatctt tgatcaccag attcatgtat gacagttttg 181 acaacaccta tcaggcaaca attggcattg actttttatc aaaaactatg tacttggagg 241 atcgaacaat caggcttcag ctgtgggata ctgcgggtca ggaacgtttc cgtagcctca 301 ttcccagtta catccgtgat tctgctgcag ctgtagtagt ttacgatatc acaaatgtta 361 actcattcca gcaaactaca aagtggattg atgatgtcag aacagaaaga ggaagtgatg 421 ttatcatCAT GCTAGTAGGA AATAAAACAG ATCTTGCTGA CAAGAGGCAA GTGTCAATTG 481 AGGAGGGAGA GAGGAAAGCC AAAGAGCTGA ATGTTATGTT TATTGAAACT AGTGCAAAAG 541 CTGGATACAA TGTAAAGCAG CTCTTTCGAC GTGTAGCAGC AGCTTTGCCG GGAATGGAAA 601 GCACACAGGA CAGAAGCAGA GAAGATATGA TTGACATAAA ACTGGAAAAG CCTCAGGAGC 661 AACCAGTCAG TGAAGGAGGC TGTTCTGCTA CCCAACTTTC TTGTACAAAG TGGTTGATAT 721 CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC 781 GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGGTTCG 841 ATCACGAGGT TACCACGAAC GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt 901 gaaagatt