Transcript: Human NM_001077637.1

Homo sapiens RAB6D, member RAS oncogene family (RAB6D), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
RAB6D (150786)
Length:
3672
CDS:
439..1203

Additional Resources:

NCBI RefSeq record:
NM_001077637.1
NBCI Gene record:
RAB6D (150786)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256578 TTTCCCTGATTACCAATATTA pLKO_005 3420 3UTR 100% 15.000 21.000 N RAB6D n/a
2 TRCN0000381227 ACCAAGATGTCCAGAATTATT pLKO_005 1598 3UTR 100% 15.000 7.500 Y RAB6C n/a
3 TRCN0000256577 CAACACCTATCAGGCAATAAT pLKO_005 555 CDS 100% 15.000 7.500 Y RAB6D n/a
4 TRCN0000256575 GGGCTGAATGTTACGTTTATT pLKO_005 877 CDS 100% 15.000 7.500 Y RAB6D n/a
5 TRCN0000380572 AGAAGACATGAGTGACATAAA pLKO_005 993 CDS 100% 13.200 6.600 Y RAB6C n/a
6 TRCN0000343547 AGGGCTGAATGTTACGTTTAT pLKO_005 876 CDS 100% 13.200 6.600 Y RAB6C n/a
7 TRCN0000382500 GACAAGAGGCAAGTGTCAATT pLKO_005 832 CDS 100% 13.200 6.600 Y RAB6A n/a
8 TRCN0000256574 GTCTCGTGGAGATGATCTATT pLKO_005 1189 CDS 100% 13.200 6.600 Y RAB6D n/a
9 TRCN0000382128 TGCTGCAGCTGTAGTAGTTTA pLKO_005 696 CDS 100% 13.200 6.600 Y RAB6A n/a
10 TRCN0000382131 ACATCTTTGATCACCAGATTC pLKO_005 517 CDS 100% 10.800 5.400 Y RAB6C n/a
11 TRCN0000256576 AGCTGTAGTAGTTTACGATAT pLKO_005 702 CDS 100% 10.800 5.400 Y RAB6D n/a
12 TRCN0000379826 GCCCACTGGAATTATCCTTTA pLKO_005 1545 3UTR 100% 10.800 5.400 Y RAB6C n/a
13 TRCN0000343548 GCTGTAGTAGTTTACGATATC pLKO_005 703 CDS 100% 10.800 5.400 Y RAB6C n/a
14 TRCN0000381625 TACTTGGAGGATGGAACAATC pLKO_005 604 CDS 100% 10.800 5.400 Y RAB6C n/a
15 TRCN0000382439 TCATTCCAGCAAACTACAAAG pLKO_005 736 CDS 100% 10.800 5.400 Y RAB6C n/a
16 TRCN0000048011 GCAATAATTGGCATTGACTTT pLKO.1 568 CDS 100% 4.950 2.475 Y RAB6C n/a
17 TRCN0000382333 AGGAAATTCAAGCTGGTGTTC pLKO_005 472 CDS 100% 4.050 2.025 Y Rab6a n/a
18 TRCN0000295355 ATCCGCTGAGGAAATTCAAGC pLKO_005 464 CDS 100% 4.050 2.025 Y Rab6a n/a
19 TRCN0000048012 GAGGAAATTCAAGCTGGTGTT pLKO.1 471 CDS 100% 4.050 2.025 Y RAB6C n/a
20 TRCN0000047984 CCAGCAAACTACAAAGTGGAT pLKO.1 741 CDS 100% 2.640 1.320 Y RAB6A n/a
21 TRCN0000048008 GTCATCTTCAACCCTTCCTCA pLKO.1 1074 CDS 100% 2.640 1.320 Y RAB6C n/a
22 TRCN0000048009 CGTTTATTGAAACTAGGGCAA pLKO.1 890 CDS 100% 2.160 1.080 Y RAB6C n/a
23 TRCN0000048010 CGTTGCAAAGACATCTTTGAT pLKO.1 507 CDS 100% 0.563 0.281 Y RAB6C n/a
24 TRCN0000381436 CATCACGCTAGTAGGAAATAG pLKO_005 798 CDS 100% 13.200 6.600 Y RAB6C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09147 pDONR223 100% 99.3% 98.4% None (many diffs) n/a
2 ccsbBroad304_09147 pLX_304 0% 99.3% 98.4% V5 (many diffs) n/a
3 ccsbBroadEn_13938 pDONR223 100% 78.8% 74.8% None (many diffs) n/a
4 ccsbBroad304_13938 pLX_304 0% 78.8% 74.8% V5 (not translated due to frame shift) (many diffs) n/a
5 TRCN0000473989 GGTTCGATCACGAGGTTACCACGA pLX_317 42.3% 78.8% 74.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV