Transcript: Human NM_032144.3

Homo sapiens RAB6C, member RAS oncogene family (RAB6C), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RAB6C (84084)
Length:
3073
CDS:
451..1215

Additional Resources:

NCBI RefSeq record:
NM_032144.3
NBCI Gene record:
RAB6C (84084)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032144.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000343493 TCTCGTGGAGGTGATCTATTA pLKO_005 1202 CDS 100% 13.200 7.920 N RAB6C n/a
2 TRCN0000381227 ACCAAGATGTCCAGAATTATT pLKO_005 1609 3UTR 100% 15.000 7.500 Y RAB6C n/a
3 TRCN0000256577 CAACACCTATCAGGCAATAAT pLKO_005 567 CDS 100% 15.000 7.500 Y RAB6D n/a
4 TRCN0000256575 GGGCTGAATGTTACGTTTATT pLKO_005 889 CDS 100% 15.000 7.500 Y RAB6D n/a
5 TRCN0000380572 AGAAGACATGAGTGACATAAA pLKO_005 1005 CDS 100% 13.200 6.600 Y RAB6C n/a
6 TRCN0000343547 AGGGCTGAATGTTACGTTTAT pLKO_005 888 CDS 100% 13.200 6.600 Y RAB6C n/a
7 TRCN0000381436 CATCACGCTAGTAGGAAATAG pLKO_005 810 CDS 100% 13.200 6.600 Y RAB6C n/a
8 TRCN0000382128 TGCTGCAGCTGTAGTAGTTTA pLKO_005 708 CDS 100% 13.200 6.600 Y RAB6A n/a
9 TRCN0000382131 ACATCTTTGATCACCAGATTC pLKO_005 529 CDS 100% 10.800 5.400 Y RAB6C n/a
10 TRCN0000256576 AGCTGTAGTAGTTTACGATAT pLKO_005 714 CDS 100% 10.800 5.400 Y RAB6D n/a
11 TRCN0000379826 GCCCACTGGAATTATCCTTTA pLKO_005 1556 3UTR 100% 10.800 5.400 Y RAB6C n/a
12 TRCN0000343548 GCTGTAGTAGTTTACGATATC pLKO_005 715 CDS 100% 10.800 5.400 Y RAB6C n/a
13 TRCN0000381625 TACTTGGAGGATGGAACAATC pLKO_005 616 CDS 100% 10.800 5.400 Y RAB6C n/a
14 TRCN0000382439 TCATTCCAGCAAACTACAAAG pLKO_005 748 CDS 100% 10.800 5.400 Y RAB6C n/a
15 TRCN0000048011 GCAATAATTGGCATTGACTTT pLKO.1 580 CDS 100% 4.950 2.475 Y RAB6C n/a
16 TRCN0000382333 AGGAAATTCAAGCTGGTGTTC pLKO_005 484 CDS 100% 4.050 2.025 Y Rab6a n/a
17 TRCN0000295355 ATCCGCTGAGGAAATTCAAGC pLKO_005 476 CDS 100% 4.050 2.025 Y Rab6a n/a
18 TRCN0000048012 GAGGAAATTCAAGCTGGTGTT pLKO.1 483 CDS 100% 4.050 2.025 Y RAB6C n/a
19 TRCN0000047984 CCAGCAAACTACAAAGTGGAT pLKO.1 753 CDS 100% 2.640 1.320 Y RAB6A n/a
20 TRCN0000048008 GTCATCTTCAACCCTTCCTCA pLKO.1 1086 CDS 100% 2.640 1.320 Y RAB6C n/a
21 TRCN0000048009 CGTTTATTGAAACTAGGGCAA pLKO.1 902 CDS 100% 2.160 1.080 Y RAB6C n/a
22 TRCN0000048010 CGTTGCAAAGACATCTTTGAT pLKO.1 519 CDS 100% 0.563 0.281 Y RAB6C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032144.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09147 pDONR223 100% 99.8% 99.6% None 475G>A n/a
2 ccsbBroad304_09147 pLX_304 0% 99.8% 99.6% V5 475G>A n/a
3 ccsbBroadEn_13938 pDONR223 100% 78.7% 74.4% None (many diffs) n/a
4 ccsbBroad304_13938 pLX_304 0% 78.7% 74.4% V5 (not translated due to frame shift) (many diffs) n/a
5 TRCN0000473989 GGTTCGATCACGAGGTTACCACGA pLX_317 42.3% 78.7% 74.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV