Transcript: Mouse NM_024287.4

Mus musculus RAB6A, member RAS oncogene family (Rab6a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rab6a (19346)
Length:
3243
CDS:
639..1265

Additional Resources:

NCBI RefSeq record:
NM_024287.4
NBCI Gene record:
Rab6a (19346)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024287.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379662 GTCCTTGATCACCCGATTCAT pLKO_005 719 CDS 100% 5.625 7.875 N Rab6a n/a
2 TRCN0000100572 CCGATTCATGTATGACAGTTT pLKO.1 731 CDS 100% 4.950 6.930 N Rab6a n/a
3 TRCN0000100574 CGTTGGAAAGACGTCCTTGAT pLKO.1 707 CDS 100% 4.950 6.930 N Rab6a n/a
4 TRCN0000288002 CGTTGGAAAGACGTCCTTGAT pLKO_005 707 CDS 100% 4.950 6.930 N Rab6a n/a
5 TRCN0000295357 ATGTACTTGGAGGATAGAACC pLKO_005 801 CDS 100% 4.050 3.240 N Rab6a n/a
6 TRCN0000379494 CATCATGCTAGTAGGAAATAA pLKO_005 998 CDS 100% 15.000 10.500 N RAB6A n/a
7 TRCN0000379588 GAGCTGAATGTTATGTTTATT pLKO_005 1077 CDS 100% 15.000 10.500 N RAB6A n/a
8 TRCN0000100570 GCTCTGGACATGGGTTCAAAT pLKO.1 2338 3UTR 100% 13.200 9.240 N Rab6a n/a
9 TRCN0000287925 GCTCTGGACATGGGTTCAAAT pLKO_005 2338 3UTR 100% 13.200 9.240 N Rab6a n/a
10 TRCN0000379592 ACACCTATCAGGCAACAATTG pLKO_005 757 CDS 100% 10.800 7.560 N RAB6A n/a
11 TRCN0000100571 CCACTGTGGCAGTTGTTGTTT pLKO.1 895 CDS 100% 5.625 3.938 N Rab6a n/a
12 TRCN0000100573 GTTTATTGAAACCAGTGCAAA pLKO.1 1091 CDS 100% 4.950 3.465 N Rab6a n/a
13 TRCN0000382333 AGGAAATTCAAGCTGGTGTTC pLKO_005 672 CDS 100% 4.050 2.835 N Rab6a n/a
14 TRCN0000295355 ATCCGCTGAGGAAATTCAAGC pLKO_005 664 CDS 100% 4.050 2.835 N Rab6a n/a
15 TRCN0000048012 GAGGAAATTCAAGCTGGTGTT pLKO.1 671 CDS 100% 4.050 2.835 N RAB6C n/a
16 TRCN0000295356 TTGATTCCTAGCTACATTCGA pLKO_005 870 CDS 100% 3.000 2.100 N Rab6a n/a
17 TRCN0000380122 GGCAGTTGTTGTTTATGATAT pLKO_005 902 CDS 100% 13.200 7.920 N Rab6a n/a
18 TRCN0000382439 TCATTCCAGCAAACTACAAAG pLKO_005 936 CDS 100% 10.800 6.480 N RAB6C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024287.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13938 pDONR223 100% 90.5% 97.1% None (many diffs) n/a
2 ccsbBroad304_13938 pLX_304 0% 90.5% 97.1% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000473989 GGTTCGATCACGAGGTTACCACGA pLX_317 42.3% 90.5% 97.1% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_09147 pDONR223 100% 72.3% 73.2% None (many diffs) n/a
5 ccsbBroad304_09147 pLX_304 0% 72.3% 73.2% V5 (many diffs) n/a
Download CSV