Construct: ORF TRCN0000474324
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009181.1_s317c1
- Derived from:
- ccsbBroadEn_05284
- DNA Barcode:
- AAAGAAAACTCAAGTACTTATAAG
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AFG1L (246269)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474324
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 246269 | AFG1L | AFG1 like ATPase | NM_145315.5 | 99.9% | 99.7% | 1443delG |
2 | human | 246269 | AFG1L | AFG1 like ATPase | XM_011535657.2 | 92.8% | 92.7% | 415_416ins102;1341delG |
3 | human | 246269 | AFG1L | AFG1 like ATPase | XM_005266885.3 | 92% | 91% | (many diffs) |
4 | human | 246269 | AFG1L | AFG1 like ATPase | XM_017010647.2 | 92% | 91% | (many diffs) |
5 | human | 246269 | AFG1L | AFG1 like ATPase | NM_001323005.2 | 90.1% | 90% | 1062_1063ins141;1302delG |
6 | human | 246269 | AFG1L | AFG1 like ATPase | XM_017010648.1 | 70.2% | 70% | 0_1ins429;1014delG |
7 | human | 246269 | AFG1L | AFG1 like ATPase | XM_017010649.1 | 70.2% | 70% | 0_1ins429;1014delG |
8 | human | 246269 | AFG1L | AFG1 like ATPase | XM_024446391.1 | 60.8% | 60.7% | 0_1ins564;879delG |
9 | human | 246269 | AFG1L | AFG1 like ATPase | XM_011535659.3 | 57.5% | 55.3% | (many diffs) |
10 | human | 246269 | AFG1L | AFG1 like ATPase | XM_011535660.2 | 57.2% | 56.7% | (many diffs) |
11 | human | 246269 | AFG1L | AFG1 like ATPase | XM_011535661.2 | 52.6% | 52.1% | (many diffs) |
12 | human | 246269 | AFG1L | AFG1 like ATPase | NR_136553.2 | 19.9% | (many diffs) | |
13 | mouse | 215951 | Afg1l | AFG1 like ATPase | NM_145743.2 | 87.8% | 86.6% | (many diffs) |
14 | mouse | 215951 | Afg1l | AFG1 like ATPase | XM_017313883.1 | 83.5% | 80.3% | (many diffs) |
15 | mouse | 215951 | Afg1l | AFG1 like ATPase | XM_006512697.3 | 62.7% | 63.8% | (many diffs) |
16 | mouse | 215951 | Afg1l | AFG1 like ATPase | XM_006512698.1 | 62.7% | 63.8% | (many diffs) |
17 | mouse | 215951 | Afg1l | AFG1 like ATPase | XM_006512700.3 | 48% | 48.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1509
- ORF length:
- 1443
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcctcctgg tcgctcttgg ttaccctgcg ccccttagca cagagcccgc 121 tgagagggag atgtgttggg tgcggggcct gggccgccgc tctcgctcct ctggccaccg 181 cccctgggaa gcccttttgg aaagcctata cggttcagac atccgagagc atgaccccaa 241 ctgccacttc agagacttat ttgaaagctt tggccgtttg ccatggacct ctggaccact 301 atgattttct gatcaaagct catgagctaa aggatgatga acatcaaaga agagtcatac 361 agtgtttgca gaaattacac gaggacctta aaggatacaa tatagaggca gaaggccttt 421 tttcaaagct tttttcaagg agcaaacctc caaggggcct gtatgtttat ggagatgttg 481 gtacaggaaa aacaatggtg atggacatgt tttatgctta tgtggaaatg aagaggaaaa 541 aacgggttca ttttcatggt ttcatgctag atgtgcacaa aagaatacat cgccttaaac 601 agagtttgcc aaaaaggaaa ccaggattca tggctaaatc atatgaccca atagctccca 661 tagccgaaga aatcagcgaa gaagcatgtc tcctatgttt tgatgaattt caggtcactg 721 acattgctga tgccatgatt ctgaaacagc tttttgaaaa tctgttcaaa aacggggtcg 781 tcgttgtggc aacatccaac aggccaccgg aagatctcta taaaaatgga ctccaaagag 841 ctaactttgt accattcata gcagtcttga aggaatattg taatacagtc cagctagatt 901 ctgggataga ttaccggaaa agggaacttc ctgctgcagg aaaactctac taCCTCACAA 961 GTGAAGCTGA TGTGGAGGCT GTCATGGATA AGTTGTTTGA TGAGCTGGCT CAGAAACAAA 1021 ATGATTTAAC TAGACCAAGG ATTCTAAAAG TGCAAGGCAG AGAGCTGCGC CTGAATAAAG 1081 CCTGTGGAAC CGTTGCCGAC TGCACATTTG AAGAGCTGTG TGAGAGACCA CTTGGAGCCA 1141 GTGACTATTT GGAACTATCA AAGAATTTTG ATACAATATT TTTACGAAAC ATTCCGCAAT 1201 TTACTCTGGC AAACAGGACT CAAGGTCGAA GATTCATAAC TCTCATCGAT AACTTTTATG 1261 ATCTCAAGGT GCGTATAATT TGCTCTGCGT CGACTCCTAT ATCAAGCTTA TTTTTGCATC 1321 AACATCATGA CAGTGAGTTG GAGCAAAGCA GAATACTGAT GGATGATTTG GGGCTGAGCC 1381 AGGATTCAGC AGAAGGACTC TCCATGTTTA CCGGAGAAGA GGAAATCTTT GCATTTCAGC 1441 GCACAATTTC CCGACTCACG GAAATGCAGA CTGAACAGTA CTGGAATGAA GGAGACAGAA 1501 CCAAGAATAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC 1561 TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT 1621 TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAAAAGAAA ACTCAAGTAC TTATAAGACG 1681 CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt