Transcript: Human NM_145315.5

Homo sapiens AFG1 like ATPase (AFG1L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
AFG1L (246269)
Length:
5048
CDS:
27..1472

Additional Resources:

NCBI RefSeq record:
NM_145315.5
NBCI Gene record:
AFG1L (246269)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145315.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145092 GCAGAATACTGATGGATGATT pLKO.1 1309 CDS 100% 5.625 4.500 N AFG1L n/a
2 TRCN0000145494 GCTGTCATGGATAAGTTGTTT pLKO.1 939 CDS 100% 5.625 4.500 N AFG1L n/a
3 TRCN0000144140 CATAGCAGTCTTGAAGGAATA pLKO.1 818 CDS 100% 10.800 7.560 N AFG1L n/a
4 TRCN0000139857 CAGGACTCAAGGTCGAAGATT pLKO.1 1175 CDS 100% 5.625 3.938 N AFG1L n/a
5 TRCN0000141170 CGAGGACCTTAAAGGATACAA pLKO.1 341 CDS 100% 5.625 3.938 N AFG1L n/a
6 TRCN0000144670 GAGGACCTTAAAGGATACAAT pLKO.1 342 CDS 100% 5.625 3.938 N AFG1L n/a
7 TRCN0000140805 GCAGAAGGACTCTCCATGTTT pLKO.1 1350 CDS 100% 5.625 3.938 N AFG1L n/a
8 TRCN0000144777 CATGAGCTAAAGGATGATGAA pLKO.1 282 CDS 100% 4.950 3.465 N AFG1L n/a
9 TRCN0000139661 CTCACGGAAATGCAGACTGAA pLKO.1 1416 CDS 100% 4.950 3.465 N AFG1L n/a
10 TRCN0000121013 GCCATGATTCTGAAACAGCTT pLKO.1 693 CDS 100% 2.640 1.848 N Afg1l n/a
11 TRCN0000336179 GCCATGATTCTGAAACAGCTT pLKO_005 693 CDS 100% 2.640 1.848 N Afg1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145315.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05284 pDONR223 100% 99.9% 99.7% None 1443delG n/a
2 ccsbBroad304_05284 pLX_304 0% 99.9% 99.7% V5 (not translated due to frame shift) 1443delG n/a
3 TRCN0000474324 AAAGAAAACTCAAGTACTTATAAG pLX_317 38.7% 99.9% 99.7% V5 (not translated due to frame shift) 1443delG n/a
Download CSV