Construct: ORF TRCN0000474412
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016778.1_s317c1
- Derived from:
- ccsbBroadEn_12046
- DNA Barcode:
- AATCGGTCAATGCTCCTGCGCGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DGCR8 (54487)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474412
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54487 | DGCR8 | DGCR8 microprocessor comple... | XM_006724268.3 | 84.8% | 84.8% | 0_1ins222 |
| 2 | human | 54487 | DGCR8 | DGCR8 microprocessor comple... | NM_022720.7 | 63.3% | 63.3% | 1_849del |
| 3 | human | 54487 | DGCR8 | DGCR8 microprocessor comple... | NM_001190326.1 | 59.1% | 59.1% | 1_849del;1604_1605ins99 |
| 4 | mouse | 94223 | Dgcr8 | DGCR8, microprocessor compl... | NM_033324.2 | 56.5% | 61.4% | (many diffs) |
| 5 | mouse | 94223 | Dgcr8 | DGCR8, microprocessor compl... | XM_006522795.2 | 55% | 59.8% | (many diffs) |
| 6 | mouse | 94223 | Dgcr8 | DGCR8, microprocessor compl... | XM_017317176.1 | 55% | 59.8% | (many diffs) |
| 7 | mouse | 94223 | Dgcr8 | DGCR8, microprocessor compl... | XR_001781877.1 | 22.2% | (many diffs) | |
| 8 | mouse | 94223 | Dgcr8 | DGCR8, microprocessor compl... | XR_001781875.1 | 22.2% | (many diffs) | |
| 9 | mouse | 94223 | Dgcr8 | DGCR8, microprocessor compl... | XR_001781878.1 | 22.2% | (many diffs) | |
| 10 | mouse | 94223 | Dgcr8 | DGCR8, microprocessor compl... | XR_001781873.1 | 21.9% | (many diffs) | |
| 11 | mouse | 94223 | Dgcr8 | DGCR8, microprocessor compl... | XR_001781876.1 | 13.2% | (many diffs) | |
| 12 | mouse | 94223 | Dgcr8 | DGCR8, microprocessor compl... | XR_001781879.1 | 12.8% | (many diffs) | |
| 13 | mouse | 94223 | Dgcr8 | DGCR8, microprocessor compl... | XR_001781874.1 | 12.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1536
- ORF length:
- 1470
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat gaccaagatt aaaacagtgc tcaaaagtcg tggccgccca cctacagagc 121 cgctgcccga cgggtggatc atgacattcc ataactctgg agtcccggtg tacctacaca 181 gagagtctcg ggtggtcacc tggtccaggc catacttctt gggaacggga agcatacgga 241 aacacgaccc tcctctgagt agcatccctt gtctgcatta taagaaaatg aaggacaacg 301 aggaacggga gcaaagcagt gacctcaccc ctagtgggga tgtgtccccc gtcaagcccc 361 tgagccgatc tgcagagctg gagtttcccc tggatgagcc tgactctatg ggtgctgacc 421 cggggccccc ggacgagaaa gacccactag gggctgaggc agcccctggg gccctggggc 481 aggtgaaggc caaagtcgag gtgtgcaaag atgaatccgt tgatctcgag gaatttcgaa 541 gctacctgga gaagcgtttt gactttgagc aagttactgt gaaaaaattc aggacttggg 601 ctgagcggcg gcaattcaat cgggaaatga agcggaagca ggcggagtcc gagaggccca 661 tcttgccagc caatcagaag ctcattactt tatcagtgca agatgcaccc acaaagaaag 721 agtttgttat taaccccaac gggaaatccg aggtctgcat cctgcacgag tacatgcagc 781 gtgtcctcaa ggtccgccct gtctataatt tctttgaatg tgagaaccca agtgagcctt 841 ttggtgcctc ggtgaccatt gatggtgtga cttacggatc tggaactgca agcagcaaaa 901 aacttgcgaa gaataaagct gcccgagcta cactggaaat cctcatccct gactttgtta 961 aacagacctc tgaagagaag cccaaagaca gtgaagaact cgagtatttt aaccacatca 1021 gcatcgagga ctcgcgggtc tacgagctga ccagcaaggc tgggctgttg tctccatatc 1081 agatcctcca cgagtgcctt aaaaGAAACC ATGGGATGGG TGACACGTCT ATCAAGTTTG 1141 AAGTGGTTCC TGGGAAAAAC CAGAAGAGTG AATACGTCAT GGCGTGTGGC AAGCACACAG 1201 TGCGCGGGTG GTGTAAGAAC AAGAGAGTTG GAAAGCAGTT AGCCTCACAG AAGATCCTTC 1261 AGCTGCTGCA CCCACATGTC AAGAACTGGG GGTCTTTACT GCGCATGTAT GGCCGTGAGA 1321 GCAGCAAGAT GGTCAAGCAG GAGACATCGG ACAAGAGTGT GATTGAGCTG CAGCAGTATG 1381 CCAAGAAGAA CAAGCCCAAC CTGCACATCC TCAGCAAGCT CCAAGAGGAG ATGAAGAGGC 1441 TAGCTGAGGA AAGGGAGGAG ACTCGAAAGA AGCCCAAGAT GTCCATTGTG GCGTCCGCCC 1501 AGCCTGGCGG TGAGCCCCTG TGCACCGTGG ACGTGTGCCC AACTTTCTTG TACAAAGTGG 1561 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1621 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1681 AAATCGGTCA ATGCTCCTGC GCGTCACGCG TTAAGTCgac aatcaacctc tggattacaa 1741 aatttgtgaa agatt