Transcript: Human NM_001190326.1

Homo sapiens DGCR8 microprocessor complex subunit (DGCR8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
DGCR8 (54487)
Length:
4437
CDS:
430..2652

Additional Resources:

NCBI RefSeq record:
NM_001190326.1
NBCI Gene record:
DGCR8 (54487)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001190326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159003 GCTCGATGAGTTAGAAGATTT pLKO.1 1023 CDS 100% 13.200 18.480 N DGCR8 n/a
2 TRCN0000165324 GCGGCAATTCAATCGGGAAAT pLKO.1 1821 CDS 100% 10.800 15.120 N DGCR8 n/a
3 TRCN0000419311 GAAAGGGAGGAGACTCGAAAG pLKO_005 2563 CDS 100% 6.000 8.400 N DGCR8 n/a
4 TRCN0000419487 GAACGGGAAGCATACGGAAAC pLKO_005 1436 CDS 100% 6.000 8.400 N DGCR8 n/a
5 TRCN0000415187 ACGGCTAAAGCAATCGTTCAG pLKO_005 1087 CDS 100% 4.050 5.670 N DGCR8 n/a
6 TRCN0000166035 CCTTCAACTTCTACGGAGCTT pLKO.1 626 CDS 100% 2.640 3.696 N DGCR8 n/a
7 TRCN0000161562 GCATCCCTTGTCTGCATTATA pLKO.1 1475 CDS 100% 15.000 12.000 N DGCR8 n/a
8 TRCN0000425737 CATCGGACAAGAGTGTGATTG pLKO_005 2459 CDS 100% 10.800 8.640 N DGCR8 n/a
9 TRCN0000161563 GCTGTTGTCTCCATATCAGAT pLKO.1 2178 CDS 100% 4.950 3.960 N DGCR8 n/a
10 TRCN0000160021 CCACAAAGAAAGAGTTTGTTA pLKO.1 1922 CDS 100% 0.563 0.450 N DGCR8 n/a
11 TRCN0000162331 CCCTGACCTTAAGTTGCTTAA pLKO.1 756 CDS 100% 10.800 7.560 N DGCR8 n/a
12 TRCN0000435432 GTGACACGTCTATCAAGTTTG pLKO_005 2234 CDS 100% 10.800 7.560 N DGCR8 n/a
13 TRCN0000158916 CCAATCAGAAGCTCATTACTT pLKO.1 1883 CDS 100% 5.625 3.938 N DGCR8 n/a
14 TRCN0000159648 GACAATTTGGAGCTAGATGAA pLKO.1 1048 CDS 100% 4.950 3.465 N DGCR8 n/a
15 TRCN0000165187 GACTCGAAAGAAGCCCAAGAT pLKO.1 2574 CDS 100% 4.950 3.465 N DGCR8 n/a
16 TRCN0000159850 GTAAAGATTAGCGTGAGCTTT pLKO.1 781 CDS 100% 4.950 3.465 N DGCR8 n/a
17 TRCN0000436748 AGTCATGCATCGTGCACCACA pLKO_005 2711 3UTR 100% 2.640 1.848 N DGCR8 n/a
18 TRCN0000193939 CGGCTAAAGCAATCGTTCAAA pLKO.1 1088 CDS 100% 5.625 7.875 N Dgcr8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12046 pDONR223 100% 59.1% 59.1% None 1_849del;1604_1605ins99 n/a
2 ccsbBroad304_12046 pLX_304 0% 59.1% 59.1% V5 1_849del;1604_1605ins99 n/a
3 TRCN0000474412 AATCGGTCAATGCTCCTGCGCGTC pLX_317 29.6% 59.1% 59.1% V5 1_849del;1604_1605ins99 n/a
4 ccsbBroadEn_14163 pDONR223 100% 40.8% 40.6% None 652G>A;906_906delGinsTGTT;910_2220del n/a
5 ccsbBroad304_14163 pLX_304 0% 40.8% 40.6% V5 652G>A;906_906delGinsTGTT;910_2220del n/a
6 TRCN0000470118 CTTACACGCCGTATAAAGAGGGCG pLX_317 43.9% 40.8% 40.6% V5 652G>A;906_906delGinsTGTT;910_2220del n/a
Download CSV