Construct: ORF TRCN0000474470
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012935.1_s317c1
- Derived from:
- ccsbBroadEn_03741
- DNA Barcode:
- TGCGATTAAGAACCGAAAGTTTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CFAP298 (56683)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474470
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56683 | CFAP298 | cilia and flagella associat... | NM_021254.4 | 100% | 100% | |
| 2 | human | 56683 | CFAP298 | cilia and flagella associat... | NM_001350337.2 | 90.8% | 87.1% | (many diffs) |
| 3 | human | 56683 | CFAP298 | cilia and flagella associat... | NM_001350336.2 | 88.9% | 88.9% | 666_667ins96 |
| 4 | human | 56683 | CFAP298 | cilia and flagella associat... | NM_001350335.1 | 81.6% | 77% | (many diffs) |
| 5 | human | 110091775 | C21orf59-TCP10L | C21orf59-TCP10L readthrough | NM_001350338.2 | 69.2% | 56.9% | (many diffs) |
| 6 | human | 56683 | CFAP298 | cilia and flagella associat... | NM_001350334.2 | 65.8% | 59.5% | 0_1ins229;75_76ins68 |
| 7 | human | 110091775 | C21orf59-TCP10L | C21orf59-TCP10L readthrough | NR_146638.2 | 11.1% | (many diffs) | |
| 8 | human | 110091775 | C21orf59-TCP10L | C21orf59-TCP10L readthrough | NR_146639.2 | 11.1% | (many diffs) | |
| 9 | mouse | 68001 | 1110004E09Rik | RIKEN cDNA 1110004E09 gene | NM_026502.2 | 84.3% | 92.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 936
- ORF length:
- 870
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt tctgctgcac gtgaagcggg gcgacgagag ccagttcctg ctgcaggcgc 121 ctgggagtac cgagctggag gagctcacgg tgcaggtggc ccgggtctat aatgggcggc 181 tcaaggtgca gcgcctctgc tcagaaatgg aagaattagc cgaacatggc atatttctcc 241 ctcctaatat gcaaggactg accgatgatc agattgaaga attgaaattg aaggatgaat 301 ggggtgaaaa atgcgtaccc agcggaggtg cagtgtttaa aaaggatgat attggacgaa 361 ggaatgggca agctccaaat gagaagatga agcaagtgtt aaagaagact atagaagaag 421 ccaaagcaat aatatctaag aaacaagtgg aagccggtgt ctgtgttacc atggagatgg 481 tgaaagatgc cttggaccag cttcgaggcg cggtgatgat tgtttacccc atggggttgc 541 caccgtatga tcccatccgc atggagtttg aaaataagga agacttgtcg ggaacacagg 601 cagggctcaa cGTCATTAAA GAGGCAGAGG CGCAGCTGTG GTGGGCAGCC AAGGAGCTGA 661 GAAGAACGAA GAAGCTTTCA GACTACGTGG GGAAGAATGA AAAAACCAAA ATTATCGCCA 721 AGATTCAGCA AAGGGGACAG GGAGCTCCAG CCCGAGAGCC TATTATTAGC AGTGAGGAGC 781 AGAAGCAGCT GATGCTGTAC TATCACAGAA GACAAGAGGA GCTCAAGAGA TTGGAAGAAA 841 ATGATGATGA TGCCTATTTA AACTCACCAT GGGCGGATAA CACTGCTTTG AAAAGACATT 901 TTCATGGAGT GAAAGACATA AAGTGGAGAC CAAGATGCCC AACTTTCTTG TACAAAGTGG 961 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1021 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1081 ATGCGATTAA GAACCGAAAG TTTCAACGCG TTAAGTCgac aatcaacctc tggattacaa 1141 aatttgtgaa agatt