Transcript: Human NM_001350336.2

Homo sapiens cilia and flagella associated protein 298 (CFAP298), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CFAP298 (56683)
Length:
3420
CDS:
135..911

Additional Resources:

NCBI RefSeq record:
NM_001350336.2
NBCI Gene record:
CFAP298 (56683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350336.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419522 GATGATGATGCCTATTTAAAC pLKO_005 816 CDS 100% 13.200 7.920 N CFAP298 n/a
2 TRCN0000137849 GCAGGGCTCAACGTCATTAAA pLKO.1 669 CDS 100% 15.000 7.500 Y CFAP298 n/a
3 TRCN0000421040 AGGAATGGGCAAGCTCCAAAT pLKO_005 429 CDS 100% 10.800 5.400 Y CFAP298 n/a
4 TRCN0000434680 ATTGAAATTGAAGGATGAATG pLKO_005 350 CDS 100% 10.800 5.400 Y CFAP298 n/a
5 TRCN0000423548 TATCGCCAAGATTCAGCAAAG pLKO_005 782 CDS 100% 6.000 3.000 Y CFAP298 n/a
6 TRCN0000435440 AGTGTTAAAGAAGACTATAGA pLKO_005 464 CDS 100% 5.625 2.813 Y CFAP298 n/a
7 TRCN0000135104 CTGACCGATGATCAGATTGAA pLKO.1 327 CDS 100% 5.625 2.813 Y CFAP298 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1197 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000429717 AGGAAGACTTGTCGGGAACAC pLKO_005 646 CDS 100% 4.050 2.025 Y CFAP298 n/a
10 TRCN0000138318 CAAGGAGCTGAGAAGAACGAA pLKO.1 719 CDS 100% 3.000 1.500 Y CFAP298 n/a
11 TRCN0000137892 GATGGTGAAAGATGCCTTGGA pLKO.1 545 CDS 100% 2.640 1.320 Y CFAP298 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1198 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350336.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03741 pDONR223 100% 88.9% 88.9% None 666_667ins96 n/a
2 ccsbBroad304_03741 pLX_304 0% 88.9% 88.9% V5 666_667ins96 n/a
3 TRCN0000474470 TGCGATTAAGAACCGAAAGTTTCA pLX_317 37.6% 88.9% 88.9% V5 666_667ins96 n/a
Download CSV