Construct: ORF TRCN0000474782
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018179.1_s317c1
- Derived from:
- ccsbBroadEn_15443
- DNA Barcode:
- GACCCAGCCTCAGCGGGTCATATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HLA-A (3105)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474782
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3105 | HLA-A | major histocompatibility co... | NM_002116.8 | 96.2% | 93.4% | (many diffs) |
| 2 | human | 3105 | HLA-A | major histocompatibility co... | NM_001242758.1 | 95.3% | 90.6% | (many diffs) |
| 3 | human | 3106 | HLA-B | major histocompatibility co... | NM_005514.8 | 88.5% | 81.9% | (many diffs) |
| 4 | human | 3107 | HLA-C | major histocompatibility co... | NM_002117.6 | 88.1% | 80% | (many diffs) |
| 5 | human | 3107 | HLA-C | major histocompatibility co... | NM_001243042.1 | 88.1% | 80% | (many diffs) |
| 6 | human | 3133 | HLA-E | major histocompatibility co... | NM_005516.6 | 85.6% | 74.3% | (many diffs) |
| 7 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010809.2 | 84.2% | 70.4% | (many diffs) |
| 8 | human | 3135 | HLA-G | major histocompatibility co... | NM_002127.5 | 82.5% | 74.7% | (many diffs) |
| 9 | human | 3135 | HLA-G | major histocompatibility co... | XM_024446420.1 | 82.5% | 74.7% | (many diffs) |
| 10 | human | 3134 | HLA-F | major histocompatibility co... | NM_018950.2 | 81.5% | 73.1% | (many diffs) |
| 11 | human | 3135 | HLA-G | major histocompatibility co... | NM_001363567.1 | 81.4% | 73.7% | (many diffs) |
| 12 | human | 3134 | HLA-F | major histocompatibility co... | XM_011514564.1 | 80.2% | 70.9% | (many diffs) |
| 13 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010813.1 | 79.4% | 69.3% | (many diffs) |
| 14 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010807.1 | 76.1% | 61.7% | (many diffs) |
| 15 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010808.1 | 76.1% | 61.7% | (many diffs) |
| 16 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010812.1 | 73.4% | 64% | (many diffs) |
| 17 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010810.1 | 71.1% | 61.8% | (many diffs) |
| 18 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098479.2 | 69.9% | 60.8% | (many diffs) |
| 19 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010817.1 | 60.5% | 55% | (many diffs) |
| 20 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010818.1 | 60.5% | 55% | (many diffs) |
| 21 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098478.2 | 59.4% | 51.2% | (many diffs) |
| 22 | human | 3136 | HLA-H | major histocompatibility co... | NR_001434.4 | 58.5% | (many diffs) | |
| 23 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010815.1 | 54.4% | 49.3% | (many diffs) |
| 24 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010814.1 | 47.6% | 41.3% | (many diffs) |
| 25 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743373.1 | 29.1% | (many diffs) | |
| 26 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743374.1 | 28% | (many diffs) | |
| 27 | human | 3139 | HLA-L | major histocompatibility co... | NR_027822.1 | 16% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1161
- ORF length:
- 1095
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cgtcatggcg ccccgaaccc tcgtcctgct actctcgggg gctctggccc 121 tgacccagac ctgggcgggc tctcactcca tgaggtattt cttcacatcc gtgtcccggc 181 ccggccgcgg ggagccccgc ttcatcgcag tgggctacgt ggacgacacg cagttcgtgc 241 ggttcgacag cgacgccgcg agccagagga tggagccgcg ggcgccgtgg atagagcagg 301 agggtccgga gtattgggac ggggagacac ggaaagtgaa ggcccactca cagactcacc 361 gagtggacct ggggaccctg cgcggctact acaaccagag cgaggccggt tctcacaccg 421 tccagaggat gtatggctgc gacgtggggt cggactggcg cttcctccgc gggtaccacc 481 agtacgccta cgacggcaag gattacatcg ccctgaaaga ggacctgcgc ccttggaccg 541 cggcggacat ggcagctcag accaccaagc acaagtggga ggcggcccat gtggcggagc 601 agttgagagc ctacctggag ggcacgtgcg tggAGTGGCT CCGCAGATAC CTGGAGAACG 661 GGAAGGAGAC GCTGCAGCGC ACGGACGCCC CCAAAACGCA TATGACTCAC CACGCTGTCT 721 CTGACCATGA AGCCACCCTG AGGTGCTGGG CCCTGAGCTT CTACCCTGCG GAGATCACAC 781 TGACCTGGCA GCGGGATGGG GAGGACCAGA CCCAGGACAC GGAGCTCGTG GAGACCAGGC 841 CTGCAGGGGA TGGAACCTTC CAGAAGTGGG CGGCTGTGGT GGTGCCTTCT GGACAGGAGC 901 AGAGATACAC CTGCCATGTG CAGCATGAGG GTTTGCCCAA GCCCCTCACC CTGAGATGGG 961 AGCCGTCTTC CCAGCCCACC ATCCCCATCG TGGGCATCAT TGCTGGCCTG GTTCTCTTTG 1021 GAGCTGTGAT CACTGGAGCT GTGGTCGCTG CTGTGATGTG GAGGAGGAAG AGCTCAGATA 1081 GAAAAGGAGG GAGCTACTCT CAGGCTGCAA GCAGTGACAG TGCCCAGGGC TCTGATGTGT 1141 CTCTCACAGC TTGTAAAGTG TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1201 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGC CCGTAACTTG 1261 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGACC CAGCCTCAGC 1321 GGGTCATATA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt