Transcript: Mouse XR_388480.2

PREDICTED: Mus musculus PITPNM family member 3 (Pitpnm3), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pitpnm3 (327958)
Length:
2697
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_388480.2
NBCI Gene record:
Pitpnm3 (327958)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_388480.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253557 ACCGTGCCAATGATGTAATTG pLKO_005 1539 3UTR 100% 13.200 18.480 N Pitpnm3 n/a
2 TRCN0000029773 GAAGAACAACTCGCGCATGAT pLKO.1 2317 3UTR 100% 4.950 6.930 N PITPNM3 n/a
3 TRCN0000217049 CTATGGCTCCACGAAAGATAT pLKO.1 2146 3UTR 100% 13.200 9.240 N Pitpnm3 n/a
4 TRCN0000253555 CCCAAGGAAGTATCGAGATTC pLKO_005 410 3UTR 100% 10.800 7.560 N Pitpnm3 n/a
5 TRCN0000203477 CCAAGGAAGTATCGAGATTCA pLKO.1 411 3UTR 100% 4.950 3.465 N Pitpnm3 n/a
6 TRCN0000203998 GAGTTCCTCAAGTCCTCTGAT pLKO.1 829 3UTR 100% 4.950 2.970 N Pitpnm3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_388480.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09092 pDONR223 100% 70.4% None (many diffs) n/a
2 ccsbBroad304_09092 pLX_304 0% 70.4% V5 (many diffs) n/a
3 TRCN0000474993 CGCCGCCATTTATAAATCCCCTAA pLX_317 10.1% 70.4% V5 (many diffs) n/a
Download CSV