Construct: ORF TRCN0000475279
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010639.1_s317c1
- Derived from:
- ccsbBroadEn_01915
- DNA Barcode:
- TATAGCGGGACGTGTAGAGTAGCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- H4C5 (8367)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475279
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8367 | H4C5 | H4 clustered histone 5 | NM_003545.3 | 100% | 100% | |
| 2 | human | 8365 | H4C8 | H4 clustered histone 8 | NM_003543.3 | 88.9% | 100% | (many diffs) |
| 3 | human | 8362 | H4C12 | H4 clustered histone 12 | NM_003541.2 | 85.4% | 100% | (many diffs) |
| 4 | human | 8363 | H4C11 | H4 clustered histone 11 | NM_021968.3 | 85.4% | 100% | (many diffs) |
| 5 | human | 8294 | H4C9 | H4 clustered histone 9 | NM_003495.2 | 84.4% | 100% | (many diffs) |
| 6 | human | 8360 | H4C4 | H4 clustered histone 4 | NM_003539.3 | 84.4% | 100% | (many diffs) |
| 7 | human | 8366 | H4C2 | H4 clustered histone 2 | NM_003544.2 | 84.1% | 100% | (many diffs) |
| 8 | human | 8359 | H4C1 | H4 clustered histone 1 | NM_003538.3 | 83.8% | 100% | (many diffs) |
| 9 | human | 8368 | H4C13 | H4 clustered histone 13 | NM_003546.2 | 83.4% | 100% | (many diffs) |
| 10 | human | 121504 | H4-16 | H4 histone 16 | NM_175054.2 | 83.1% | 100% | (many diffs) |
| 11 | human | 554313 | H4C15 | H4 clustered histone 15 | NM_001034077.4 | 82.2% | 100% | (many diffs) |
| 12 | human | 8370 | H4C14 | H4 clustered histone 14 | NM_003548.2 | 82.2% | 100% | (many diffs) |
| 13 | human | 8364 | H4C3 | H4 clustered histone 3 | NM_003542.3 | 81.2% | 100% | (many diffs) |
| 14 | human | 8361 | H4C6 | H4 clustered histone 6 | NM_003540.3 | 80.9% | 100% | (many diffs) |
| 15 | mouse | 326619 | Hist1h4a | histone cluster 1, H4a | NM_178192.2 | 85.1% | 100% | (many diffs) |
| 16 | mouse | 100041230 | Hist1h4m | histone cluster 1, H4m | NM_001195421.1 | 84.1% | 100% | (many diffs) |
| 17 | mouse | 319157 | Hist1h4f | histone cluster 1, H4f | NM_175655.2 | 84.1% | 100% | (many diffs) |
| 18 | mouse | 319161 | Hist1h4n | histone cluster 1, H4n | NM_175657.2 | 84.1% | 100% | (many diffs) |
| 19 | mouse | 319155 | Hist1h4c | histone cluster 1, H4c | NM_178208.2 | 84.1% | 100% | (many diffs) |
| 20 | mouse | 326620 | Hist1h4b | histone cluster 1, H4b | NM_178193.2 | 83.8% | 100% | (many diffs) |
| 21 | mouse | 319159 | Hist1h4j | histone cluster 1, H4j | NM_178210.2 | 83.5% | 100% | (many diffs) |
| 22 | mouse | 319160 | Hist1h4k | histone cluster 1, H4k | NM_178211.2 | 83.5% | 100% | (many diffs) |
| 23 | mouse | 319158 | Hist1h4i | histone cluster 1, H4i | NM_175656.3 | 83.4% | 100% | (many diffs) |
| 24 | mouse | 69386 | Hist1h4h | histone cluster 1, H4h | NM_153173.4 | 83.1% | 100% | (many diffs) |
| 25 | mouse | 319156 | Hist1h4d | histone cluster 1, H4d | NM_175654.2 | 83.1% | 100% | (many diffs) |
| 26 | mouse | 320332 | Hist4h4 | histone cluster 4, H4 | NM_175652.3 | 82.5% | 100% | (many diffs) |
| 27 | mouse | 97122 | Hist2h4 | histone cluster 2, H4 | NM_033596.3 | 81.2% | 100% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 375
- ORF length:
- 309
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tggtcgcggc aaaggcggaa agggactggg taaaggaggc gctaagcgtc 121 accgtaaggt cctgcgagat aacatccagg gcattaccaa gcctgccatc cggcgccttg 181 ctcgtcgcgg gggtgtcaag cgcatttctg gtctcatcta cgaggagact cgcggggttc 241 tgaaggtgtt tctggaaaac gtgattcgtg atgctgtgac ttacacggag cacgCCAAAC 301 GCAAGACAGT GACAGCGATG GATGTGGTCT ACGCGCTGAA GAGACAGGGA CGCACTCTTT 361 ACGGCTTCGG CGGCTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 421 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 481 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TATAGCGGGA CGTGTAGAGT 541 AGCTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt