Transcript: Human NM_175054.2

Homo sapiens H4 histone 16 (H4-16), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
H4-16 (121504)
Length:
412
CDS:
48..359

Additional Resources:

NCBI RefSeq record:
NM_175054.2
NBCI Gene record:
H4-16 (121504)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074265 ACAATATCCAAGGCATTACAA pLKO.1 121 CDS 100% 5.625 3.938 N H4-16 n/a
2 TRCN0000074263 CGGGACAATATCCAAGGCATT pLKO.1 117 CDS 100% 4.050 2.835 N H4-16 n/a
3 TRCN0000074266 TGATCCGTGACGCGGTGACTT pLKO.1 244 CDS 100% 1.650 1.155 N H4-16 n/a
4 TRCN0000434859 GAAGGTGCTGCGGGACAATAT pLKO_005 107 CDS 100% 13.200 7.920 N H4-16 n/a
5 TRCN0000430921 ATGTGGTGTACGCGCTGAAAC pLKO_005 304 CDS 100% 10.800 6.480 N H4-16 n/a
6 TRCN0000074264 CCTCAAAGTCTTCCTGGAGAA pLKO.1 221 CDS 100% 4.050 2.430 N H4-16 n/a
7 TRCN0000425361 AGCGCATTTCTGGTCTCATCT pLKO_005 181 CDS 100% 4.950 2.475 Y H4C5 n/a
8 TRCN0000074267 GCGCATTTCTGGTCTCATCTA pLKO.1 182 CDS 100% 4.950 2.475 Y H4-16 n/a
9 TRCN0000092752 CTCATCTACGAGGAGACCCGT pLKO.1 195 CDS 100% 0.220 0.132 N Hist1h4d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01910 pDONR223 100% 84.4% 100% None (many diffs) n/a
2 ccsbBroad304_01910 pLX_304 0% 84.4% 100% V5 (many diffs) n/a
3 TRCN0000470331 GGAGTACAACATTTCGGGTCCGAA pLX_317 100% 84.4% 100% V5 (many diffs) n/a
4 ccsbBroadEn_07216 pDONR223 100% 84.4% 100% None (many diffs) n/a
5 ccsbBroad304_07216 pLX_304 0% 84.4% 100% V5 (many diffs) n/a
6 TRCN0000468808 CGAAACCTGTGAAAGAAATAGCCA pLX_317 100% 84.4% 100% V5 (many diffs) n/a
7 ccsbBroadEn_01883 pDONR223 100% 84.1% 100% None (many diffs) n/a
8 ccsbBroad304_01883 pLX_304 0% 84.1% 100% V5 (many diffs) n/a
9 TRCN0000470786 AAACACGGTAGAGCCAAGTCGACG pLX_317 100% 84.1% 100% V5 (many diffs) n/a
10 ccsbBroadEn_01915 pDONR223 100% 83.1% 100% None (many diffs) n/a
11 ccsbBroad304_01915 pLX_304 0% 83.1% 100% V5 (many diffs) n/a
12 TRCN0000475279 TATAGCGGGACGTGTAGAGTAGCT pLX_317 27.6% 83.1% 100% V5 (many diffs) n/a
13 ccsbBroadEn_01912 pDONR223 100% 83.1% 100% None (many diffs) n/a
14 ccsbBroad304_01912 pLX_304 0% 83.1% 100% V5 (many diffs) n/a
15 TRCN0000472437 ACTCCACAACGATCTTTCCTTCAT pLX_317 100% 83.1% 100% V5 (many diffs) n/a
16 ccsbBroadEn_01914 pDONR223 100% 82.2% 100% None (many diffs) n/a
17 ccsbBroad304_01914 pLX_304 0% 82.2% 100% V5 (many diffs) n/a
18 TRCN0000470478 ACCAGTGCAGTTCTATCGAGTATT pLX_317 100% 82.2% 100% V5 (many diffs) n/a
19 ccsbBroadEn_01916 pDONR223 100% 81.2% 100% None (many diffs) n/a
20 ccsbBroad304_01916 pLX_304 0% 81.2% 100% V5 (many diffs) n/a
21 TRCN0000468855 AAAAGGGCACCCCGTTGTGATCCC pLX_317 100% 81.2% 100% V5 (many diffs) n/a
22 ccsbBroadEn_01913 pDONR223 100% 80.9% 100% None (many diffs) n/a
23 ccsbBroad304_01913 pLX_304 0% 80.9% 100% V5 (many diffs) n/a
24 TRCN0000465747 GTATTTCCGCGAATCGGGTCGGAG pLX_317 100% 80.9% 100% V5 (many diffs) n/a
25 ccsbBroadEn_05703 pDONR223 100% 80.9% 100% None (many diffs) n/a
26 ccsbBroad304_05703 pLX_304 0% 80.9% 100% V5 (many diffs) n/a
27 TRCN0000478553 TTTATTGTGCGATTTATCCGATTA pLX_317 82.9% 80.9% 100% V5 (many diffs) n/a
28 ccsbBroadEn_11268 pDONR223 100% 80.5% 100% None (many diffs) n/a
29 ccsbBroad304_11268 pLX_304 0% 80.5% 100% V5 (many diffs) n/a
30 TRCN0000473699 AAATTGTTGTTGTCACATGCCGTA pLX_317 100% 80.5% 100% V5 (many diffs) n/a
31 ccsbBroadEn_01911 pDONR223 100% 80.2% 100% None (many diffs) n/a
32 ccsbBroad304_01911 pLX_304 0% 80.2% 100% V5 (many diffs) n/a
33 TRCN0000472587 AGGCTCCAGTCGACTTCTCCCACC pLX_317 100% 80.2% 100% V5 (many diffs) n/a
34 ccsbBroadEn_07227 pDONR223 100% 80.1% 99% None (many diffs) n/a
35 ccsbBroad304_07227 pLX_304 0% 80.1% 99% V5 (many diffs) n/a
36 TRCN0000466667 ACAGCTATGCTGGGTCCGATAGTT pLX_317 69.3% 80.1% 99% V5 (many diffs) n/a
Download CSV