Construct: ORF TRCN0000475614
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003694.1_s317c1
- Derived from:
- ccsbBroadEn_13742
- DNA Barcode:
- GCGTCAAACGAAAACCATTCTATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDK11A (728642)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475614
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_024451190.1 | 98.9% | 98.9% | (many diffs) |
| 2 | human | 984 | CDK11B | cyclin dependent kinase 11B | NM_033487.3 | 74.6% | 69.9% | (many diffs) |
| 3 | human | 984 | CDK11B | cyclin dependent kinase 11B | NM_033490.3 | 69.4% | 65.1% | (many diffs) |
| 4 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_024451184.1 | 67.9% | 63.6% | (many diffs) |
| 5 | human | 984 | CDK11B | cyclin dependent kinase 11B | NM_033489.3 | 52.4% | 49.2% | (many diffs) |
| 6 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_011542495.3 | 51.6% | 48.4% | (many diffs) |
| 7 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_017002928.2 | 51.5% | 48.4% | (many diffs) |
| 8 | human | 728642 | CDK11A | cyclin dependent kinase 11A | NM_033529.4 | 51.4% | 48.3% | (many diffs) |
| 9 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_011542494.3 | 50.9% | 47.8% | (many diffs) |
| 10 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_017002927.2 | 50.9% | 47.8% | (many diffs) |
| 11 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_024451174.1 | 50.9% | 47.8% | (many diffs) |
| 12 | human | 984 | CDK11B | cyclin dependent kinase 11B | NM_001291345.2 | 50.8% | 47.7% | (many diffs) |
| 13 | human | 728642 | CDK11A | cyclin dependent kinase 11A | NM_001313982.2 | 50.8% | 47.8% | (many diffs) |
| 14 | human | 728642 | CDK11A | cyclin dependent kinase 11A | NM_024011.4 | 50.7% | 47.7% | (many diffs) |
| 15 | human | 728642 | CDK11A | cyclin dependent kinase 11A | NM_001313896.2 | 50.5% | 47.5% | (many diffs) |
| 16 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_017002926.2 | 50.2% | 47.1% | (many diffs) |
| 17 | human | 984 | CDK11B | cyclin dependent kinase 11B | NM_033486.3 | 50.2% | 47.1% | (many diffs) |
| 18 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_006711065.4 | 50% | 46.9% | (many diffs) |
| 19 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_017002925.2 | 49.6% | 46.5% | (many diffs) |
| 20 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_011542493.3 | 49.4% | 46.4% | (many diffs) |
| 21 | human | 984 | CDK11B | cyclin dependent kinase 11B | NM_001787.3 | 49.3% | 46.3% | (many diffs) |
| 22 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_011542490.3 | 48.8% | 45.8% | (many diffs) |
| 23 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_011542491.2 | 48.8% | 45.8% | (many diffs) |
| 24 | human | 984 | CDK11B | cyclin dependent kinase 11B | XM_011542492.2 | 48.8% | 45.8% | (many diffs) |
| 25 | human | 728642 | CDK11A | cyclin dependent kinase 11A | NR_132739.2 | 41.4% | (many diffs) | |
| 26 | human | 728642 | CDK11A | cyclin dependent kinase 11A | NR_132740.2 | 40.8% | (many diffs) | |
| 27 | human | 984 | CDK11B | cyclin dependent kinase 11B | XR_002958173.1 | 31.5% | (many diffs) | |
| 28 | human | 984 | CDK11B | cyclin dependent kinase 11B | XR_002958171.1 | 30.1% | (many diffs) | |
| 29 | human | 984 | CDK11B | cyclin dependent kinase 11B | XR_002958174.1 | 15.2% | (many diffs) | |
| 30 | human | 984 | CDK11B | cyclin dependent kinase 11B | XR_002958172.1 | 14.7% | (many diffs) | |
| 31 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | XM_017319933.1 | 78.8% | 81.9% | (many diffs) |
| 32 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | XM_017319934.1 | 78.8% | 81.9% | (many diffs) |
| 33 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | XM_006538512.3 | 61% | 63.5% | (many diffs) |
| 34 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | XM_017319932.1 | 61% | 63.5% | (many diffs) |
| 35 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | XM_017319931.1 | 46.1% | 48.1% | (many diffs) |
| 36 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | NM_001347308.1 | 46.1% | 48% | (many diffs) |
| 37 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | XM_006538511.2 | 46.1% | 48% | (many diffs) |
| 38 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | XM_017319930.1 | 46.1% | 48% | (many diffs) |
| 39 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | XM_006538508.2 | 44.1% | 46% | (many diffs) |
| 40 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | XM_017319929.1 | 44.1% | 46% | (many diffs) |
| 41 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | NM_007661.3 | 44.1% | 45.9% | (many diffs) |
| 42 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | XM_011250179.2 | 44.1% | 45.9% | (many diffs) |
| 43 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | XR_001784084.1 | 39.9% | (many diffs) | |
| 44 | mouse | 12537 | Cdk11b | cyclin-dependent kinase 11B | XR_001784083.1 | 35.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1260
- ORF length:
- 1191
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaagaacgag aaaatgaaaa ccacctcttg gttgttccag agtcacggtt 121 cgaccgagat tccggggaga gtgaagaagc agaggaagaa gtggggctgc cggagcgtcg 181 aggagttcca gtgcctgaac aggatcgagg agggcaccta tggagtggtc tacagagcaa 241 aagacaagaa aacagatgaa attgtggctc taaagcggct gaagatggag aaggagaagg 301 agggcttccc gatcacgtcc ctgagggaga tcaacaccat cctcaaggcc cagcatccca 361 acattgtcac cgttagagag attgtggtgg gcagcaacat ggacaagatc tacatcgtga 421 tgaactatgt ggagcacgac ctcaagagcc tgatggagac catgaaacag cccttcctgc 481 caggggaggt gaagaccctg atgatccagc tgctgcgtgg ggtgaaacac ctgcacgaca 541 actggatcct gcaccgtgac ctcaagacgt ccaacctgct gctgagccac gccggcatcc 601 tcaaggtggg tgattttggg ctggcgcggg agtacggatc ccctctgaag gcctacaccc 661 cggtcgtggt gacccagtgg taccgcgccc cagagctgct gcttggtgcc aaggaatact 721 ccacggccgt ggacatgtgg tcagtgggct gcatcttcgg ggagctgctg actcagaagc 781 ctctgttccc cgggaattcg gaaatcgatc agatcaacaa agtgttcaag gagctgggga 841 cccccagtga gaaaatctgg cccggctaca gtgagctccc agtagtcaag aagatgacct 901 tcagcgagca cccctacaac aacctccgca agcgcttcgg ggctctgctc tcagaccagg 961 gcttcgacct catgaacaag ttcctgacct acttccccgg gaggaggatc agcgctgagg 1021 acggcctcaa gcatgagtat ttccgcgaga cccccctccc catcgacccc tccatgttcc 1081 ccacgtggcc cgccaagagc gagcagcagc gtgtgaagcg gggcaccagc ccgaggcccc 1141 cTGAGGGAGG CCTGGGCTAC AGCCAGCTGG GTGACGACGA CCTGAAGGAG ACGGGCTTCC 1201 ACCTTACCAC CACGAACCAG GGGGCCTCTG CCGCGGGCCC CGGCTTCAGC CTCAAGTTCT 1261 TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1321 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1381 TTTATATATC TTGTGGAAAG GACGAGCGTC AAACGAAAAC CATTCTATAA CGCGTTAAGT 1441 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt