Transcript: Human NM_024011.4

Homo sapiens cyclin dependent kinase 11A (CDK11A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CDK11A (728642)
Length:
2984
CDS:
114..2456

Additional Resources:

NCBI RefSeq record:
NM_024011.4
NBCI Gene record:
CDK11A (728642)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024011.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381046 ATGTAGGCATCATAGCCATTC pLKO_005 437 CDS 100% 6.000 4.200 N CDK11A n/a
2 TRCN0000382462 AGTGAGCTCCCAGTAGTCAAA pLKO_005 2064 CDS 100% 4.950 3.465 N CDK11A n/a
3 TRCN0000380726 CACTGCATGGAGATCACAATA pLKO_005 279 CDS 100% 13.200 7.920 N CDK11A n/a
4 TRCN0000381290 CATCCTCAAGGTGGGTGATTT pLKO_005 1790 CDS 100% 13.200 7.920 N CDK11A n/a
5 TRCN0000379894 ACATCGAGAAGAACAGGATAA pLKO_005 515 CDS 100% 10.800 6.480 N CDK11A n/a
6 TRCN0000379917 TATAGAAGAGAAGACTCAATG pLKO_005 312 CDS 100% 10.800 6.480 N CDK11A n/a
7 TRCN0000006991 CGATCAGATCAACAAAGTGTT pLKO.1 2000 CDS 100% 4.950 2.970 N CDK11A n/a
8 TRCN0000006208 CGGAAACGACATCGAGAAGAA pLKO.1 507 CDS 100% 4.950 2.970 N CDK11B n/a
9 TRCN0000314614 CGGAAACGACATCGAGAAGAA pLKO_005 507 CDS 100% 4.950 2.970 N CDK11B n/a
10 TRCN0000006995 CATCCCAACATTGTCACCGTT pLKO.1 1548 CDS 100% 2.640 1.584 N CDK11A n/a
11 TRCN0000314617 ACGGCCTCAAGCATGAGTATT pLKO_005 2215 CDS 100% 13.200 6.600 Y CDK11B n/a
12 TRCN0000380353 AGAGGAGAAAGCAGAGATAAA pLKO_005 191 CDS 100% 13.200 6.600 Y CDK11A n/a
13 TRCN0000380296 AGATGAAATTGTGGCTCTAAA pLKO_005 1448 CDS 100% 13.200 6.600 Y CDK11A n/a
14 TRCN0000006209 CGGCCTCAAGCATGAGTATTT pLKO.1 2216 CDS 100% 13.200 6.600 Y CDK11B n/a
15 TRCN0000380853 GGCCTCAAGCATGAGTATTTC pLKO_005 2217 CDS 100% 13.200 6.600 Y CDK11A n/a
16 TRCN0000379886 ACTACAGCGACAAAGTGAAAG pLKO_005 769 CDS 100% 10.800 5.400 Y CDK11A n/a
17 TRCN0000356004 ATGATTCTTTGGCCATCAAAC pLKO_005 352 CDS 100% 10.800 5.400 Y CDK11B n/a
18 TRCN0000356003 CCGCTTGGAGCAGTTAGAAAG pLKO_005 605 CDS 100% 10.800 5.400 Y CDK11B n/a
19 TRCN0000314695 GAGAGGACTACAGCGACAAAG pLKO_005 763 CDS 100% 10.800 5.400 Y CDK11B n/a
20 TRCN0000196704 GATGAAATTGTGGCTCTAAAG pLKO.1 1449 CDS 100% 10.800 5.400 Y CDK11B n/a
21 TRCN0000380294 GCCTGATGGAGACCATGAAAC pLKO_005 1642 CDS 100% 10.800 5.400 Y CDK11A n/a
22 TRCN0000380611 GCTGCTTGGTGCCAAGGAATA pLKO_005 1892 CDS 100% 10.800 5.400 Y CDK11A n/a
23 TRCN0000379745 GGAAGCATGCTAGAGTGAAAG pLKO_005 469 CDS 100% 10.800 5.400 Y CDK11A n/a
24 TRCN0000196539 GATGATTCTTTGGCCATCAAA pLKO.1 351 CDS 100% 5.625 2.813 Y CDK11B n/a
25 TRCN0000006994 CAAGAGGAGAAAGCAGAGATA pLKO.1 189 CDS 100% 4.950 2.475 Y CDK11A n/a
26 TRCN0000006210 CAGATGAAATTGTGGCTCTAA pLKO.1 1447 CDS 100% 4.950 2.475 Y CDK11B n/a
27 TRCN0000006992 CGTATAGAAGAGAAGACTCAA pLKO.1 310 CDS 100% 4.950 2.475 Y CDK11A n/a
28 TRCN0000197027 GCAGCAACATGGACAAGATCT pLKO.1 1585 CDS 100% 4.950 2.475 Y CDK11A n/a
29 TRCN0000380388 GTGAAGATGAAGAACGAGAAA pLKO_005 1141 CDS 100% 4.950 2.475 Y CDK11A n/a
30 TRCN0000006206 GCCGAAGAAGTAAGTGAGGAA pLKO.1 1113 CDS 100% 2.640 1.320 Y CDK11B n/a
31 TRCN0000355952 TCTACATCGTGATGAACTATG pLKO_005 1603 CDS 100% 10.800 5.400 Y CDK11B n/a
32 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 979 CDS 100% 4.050 2.025 Y Myt1 n/a
33 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 1048 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024011.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14570 pDONR223 69.3% 97.8% 65.2% None (many diffs) n/a
2 ccsbBroad304_14570 pLX_304 0% 97.8% 65.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_13742 pDONR223 100% 50.7% 47.7% None (many diffs) n/a
4 ccsbBroad304_13742 pLX_304 0% 50.7% 47.7% V5 (many diffs) n/a
5 TRCN0000475614 GCGTCAAACGAAAACCATTCTATA pLX_317 10.6% 50.7% 47.7% V5 (many diffs) n/a
6 TRCN0000467626 TAGTGACAATCAACTTACAGCGAA pLX_317 38.1% 36.9% .6% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_14571 pDONR223 100% 36.9% .6% None (many diffs) n/a
8 ccsbBroad304_14571 pLX_304 0% 36.9% .6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV