Transcript: Human XM_011542490.3

PREDICTED: Homo sapiens cyclin dependent kinase 11B (CDK11B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDK11B (984)
Length:
3672
CDS:
720..3134

Additional Resources:

NCBI RefSeq record:
XM_011542490.3
NBCI Gene record:
CDK11B (984)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542490.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197007 GCAGTCAAGAAGATGACCTTC pLKO.1 2754 CDS 100% 4.050 2.835 N CDK11B n/a
2 TRCN0000196705 GAAGTCAGAAATCGATCAGAT pLKO.1 2666 CDS 100% 4.950 2.970 N CDK11B n/a
3 TRCN0000006207 CGATCAGATCAACAAGGTGTT pLKO.1 2678 CDS 100% 4.050 2.430 N CDK11B n/a
4 TRCN0000314694 CGATCAGATCAACAAGGTGTT pLKO_005 2678 CDS 100% 4.050 2.430 N CDK11B n/a
5 TRCN0000314617 ACGGCCTCAAGCATGAGTATT pLKO_005 2893 CDS 100% 13.200 6.600 Y CDK11B n/a
6 TRCN0000380353 AGAGGAGAAAGCAGAGATAAA pLKO_005 797 CDS 100% 13.200 6.600 Y CDK11A n/a
7 TRCN0000380296 AGATGAAATTGTGGCTCTAAA pLKO_005 2126 CDS 100% 13.200 6.600 Y CDK11A n/a
8 TRCN0000006209 CGGCCTCAAGCATGAGTATTT pLKO.1 2894 CDS 100% 13.200 6.600 Y CDK11B n/a
9 TRCN0000196946 GCAGAAGCCAGCACAGTTAAA pLKO.1 1523 CDS 100% 13.200 6.600 Y CDK11B n/a
10 TRCN0000380853 GGCCTCAAGCATGAGTATTTC pLKO_005 2895 CDS 100% 13.200 6.600 Y CDK11A n/a
11 TRCN0000379886 ACTACAGCGACAAAGTGAAAG pLKO_005 1408 CDS 100% 10.800 5.400 Y CDK11A n/a
12 TRCN0000356004 ATGATTCTTTGGCCATCAAAC pLKO_005 958 CDS 100% 10.800 5.400 Y CDK11B n/a
13 TRCN0000356003 CCGCTTGGAGCAGTTAGAAAG pLKO_005 1244 CDS 100% 10.800 5.400 Y CDK11B n/a
14 TRCN0000314695 GAGAGGACTACAGCGACAAAG pLKO_005 1402 CDS 100% 10.800 5.400 Y CDK11B n/a
15 TRCN0000196704 GATGAAATTGTGGCTCTAAAG pLKO.1 2127 CDS 100% 10.800 5.400 Y CDK11B n/a
16 TRCN0000380294 GCCTGATGGAGACCATGAAAC pLKO_005 2320 CDS 100% 10.800 5.400 Y CDK11A n/a
17 TRCN0000380611 GCTGCTTGGTGCCAAGGAATA pLKO_005 2570 CDS 100% 10.800 5.400 Y CDK11A n/a
18 TRCN0000379745 GGAAGCATGCTAGAGTGAAAG pLKO_005 1075 CDS 100% 10.800 5.400 Y CDK11A n/a
19 TRCN0000355952 TCTACATCGTGATGAACTATG pLKO_005 2281 CDS 100% 10.800 5.400 Y CDK11B n/a
20 TRCN0000196539 GATGATTCTTTGGCCATCAAA pLKO.1 957 CDS 100% 5.625 2.813 Y CDK11B n/a
21 TRCN0000006994 CAAGAGGAGAAAGCAGAGATA pLKO.1 795 CDS 100% 4.950 2.475 Y CDK11A n/a
22 TRCN0000006210 CAGATGAAATTGTGGCTCTAA pLKO.1 2125 CDS 100% 4.950 2.475 Y CDK11B n/a
23 TRCN0000197027 GCAGCAACATGGACAAGATCT pLKO.1 2263 CDS 100% 4.950 2.475 Y CDK11A n/a
24 TRCN0000380388 GTGAAGATGAAGAACGAGAAA pLKO_005 1819 CDS 100% 4.950 2.475 Y CDK11A n/a
25 TRCN0000006206 GCCGAAGAAGTAAGTGAGGAA pLKO.1 1791 CDS 100% 2.640 1.320 Y CDK11B n/a
26 TRCN0000006992 CGTATAGAAGAGAAGACTCAA pLKO.1 916 CDS 100% 4.950 2.475 Y CDK11A n/a
27 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 1657 CDS 100% 4.050 2.025 Y Myt1 n/a
28 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 1726 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542490.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14570 pDONR223 69.3% 96.4% 64.3% None (many diffs) n/a
2 ccsbBroad304_14570 pLX_304 0% 96.4% 64.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_13742 pDONR223 100% 48.8% 45.8% None (many diffs) n/a
4 ccsbBroad304_13742 pLX_304 0% 48.8% 45.8% V5 (many diffs) n/a
5 TRCN0000475614 GCGTCAAACGAAAACCATTCTATA pLX_317 10.6% 48.8% 45.8% V5 (many diffs) n/a
6 TRCN0000467626 TAGTGACAATCAACTTACAGCGAA pLX_317 38.1% 36.6% .6% V5 (not translated due to prior stop codon) 11delA;493_519del;533_2033del n/a
7 ccsbBroadEn_14571 pDONR223 100% 36.5% .6% None (many diffs) n/a
8 ccsbBroad304_14571 pLX_304 0% 36.5% .6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV