Transcript: Mouse XM_017319929.1

PREDICTED: Mus musculus cyclin-dependent kinase 11B (Cdk11b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdk11b (12537)
Length:
2606
CDS:
104..2455

Additional Resources:

NCBI RefSeq record:
XM_017319929.1
NBCI Gene record:
Cdk11b (12537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319929.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361022 GGTCGGTAGGCTGCATATTTG pLKO_005 1932 CDS 100% 13.200 18.480 N Cdk11b n/a
2 TRCN0000361087 TTCAGCGAGTATCCCTATAAC pLKO_005 2093 CDS 100% 13.200 18.480 N Cdk11b n/a
3 TRCN0000023039 CCTACACTCCAGTTGTTGTAA pLKO.1 1845 CDS 100% 5.625 4.500 N Cdk11b n/a
4 TRCN0000361085 ATGGCCTCAAGCACGAATATT pLKO_005 2214 CDS 100% 15.000 10.500 N Cdk11b n/a
5 TRCN0000380353 AGAGGAGAAAGCAGAGATAAA pLKO_005 181 CDS 100% 13.200 9.240 N CDK11A n/a
6 TRCN0000361023 TGTGGCTCTGAAGCGGTTAAA pLKO_005 1456 CDS 100% 13.200 9.240 N Cdk11b n/a
7 TRCN0000023042 CCTGGGAAGTCAGATATTGAT pLKO.1 1982 CDS 100% 5.625 3.938 N Cdk11b n/a
8 TRCN0000023043 GTGATGAACTACGTGGAACAT pLKO.1 1610 CDS 100% 4.950 3.465 N Cdk11b n/a
9 TRCN0000023040 GCCAGAGTGAAAGAGAAAGAA pLKO.1 467 CDS 100% 5.625 3.375 N Cdk11b n/a
10 TRCN0000006994 CAAGAGGAGAAAGCAGAGATA pLKO.1 179 CDS 100% 4.950 2.970 N CDK11A n/a
11 TRCN0000006210 CAGATGAAATTGTGGCTCTAA pLKO.1 1446 CDS 100% 4.950 3.465 N CDK11B n/a
12 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 1052 CDS 100% 4.950 2.475 Y PTMA n/a
13 TRCN0000165520 GAGGAGGAAGAAGAGGAGAAA pLKO.1 1058 CDS 100% 4.950 2.475 Y AP5B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319929.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14570 pDONR223 69.3% 86.4% 63.9% None (many diffs) n/a
2 ccsbBroad304_14570 pLX_304 0% 86.4% 63.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_13742 pDONR223 100% 44.1% 46% None (many diffs) n/a
4 ccsbBroad304_13742 pLX_304 0% 44.1% 46% V5 (many diffs) n/a
5 TRCN0000475614 GCGTCAAACGAAAACCATTCTATA pLX_317 10.6% 44.1% 46% V5 (many diffs) n/a
6 TRCN0000467626 TAGTGACAATCAACTTACAGCGAA pLX_317 38.1% 33.8% .6% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_14571 pDONR223 100% 33.8% .6% None (many diffs) n/a
8 ccsbBroad304_14571 pLX_304 0% 33.8% .6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV