Construct: ORF TRCN0000475702
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016263.1_s317c1
- Derived from:
- ccsbBroadEn_05652
- DNA Barcode:
- AACACTTCCATCGGCATTTGCATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VWC2L (402117)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475702
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 402117 | VWC2L | von Willebrand factor C dom... | NM_001080500.4 | 100% | 100% | |
| 2 | human | 402117 | VWC2L | von Willebrand factor C dom... | NM_001345929.2 | 62.6% | 59% | 389_390ins130;417_418ins119 |
| 3 | human | 402117 | VWC2L | von Willebrand factor C dom... | NR_159945.1 | 13.9% | 1_813del;1332_1481del;1630_4788del | |
| 4 | mouse | 320460 | Vwc2l | von Willebrand factor C dom... | NM_177164.3 | 94.7% | 98.6% | (many diffs) |
| 5 | mouse | 320460 | Vwc2l | von Willebrand factor C dom... | XM_006496063.3 | 94.7% | 98.6% | (many diffs) |
| 6 | mouse | 320460 | Vwc2l | von Willebrand factor C dom... | XM_006496064.2 | 74.7% | 77% | (many diffs) |
| 7 | mouse | 320460 | Vwc2l | von Willebrand factor C dom... | NM_001310658.1 | 58.5% | 58.5% | (many diffs) |
| 8 | mouse | 320460 | Vwc2l | von Willebrand factor C dom... | XR_373257.3 | 27.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 735
- ORF length:
- 666
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctcttcat attcatgaag cttgcatact tctgttggtc atccctggat 121 tggtcacctc tgctgctatc agtcatgaag actatcctgc tgatgaaggt gaccagatct 181 ccagtaatga caatctgatc tttgatgact atcgagggaa agggtgtgtc gatgacagcg 241 gctttgtata caagttggga gaacgatttt tccctgggca ttccaactgt ccatgtgtct 301 gtgctctaga tggacctgtt tgcgaccaac cagaatgccc taaaattcac ccaaagtgta 361 ctaaagtgga acacaatgga tgctgtccTG AGTGCAAAGA AGTAAAAAAC TTCTGTGAAT 421 ATCACGGGAA AAATTACAAA ATCTTGGAGG AATTTAAGCC CTCTCCATGT GAATGGTGTC 481 GCTGTGAGCC CAGCAATGAA GTTCACTGTG TTGTAGCAGA CTGCGCAGTT CCTGAGTGTG 541 TCAACCCAGT CTATGAACCA GAACAATGTT GTCCTGTCTG CAAAAATGGT CCAAACTGCT 601 TTGCAGGAAC GACGATAATT CCAGCTGGCA TTGAAGTGAA AGTGGACGAA TGTAACATCT 661 GTCATTGTCA CAACGGGGAC TGGTGGAAGC CTGCTCAGTG TTCGAAACGT GAATGCCAAG 721 GCAAGCAGAC TGTGTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 781 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 841 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AACACTTCCA TCGGCATTTG 901 CATAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt