Transcript: Mouse NM_001310658.1

Mus musculus von Willebrand factor C domain-containing protein 2-like (Vwc2l), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Vwc2l (320460)
Length:
4524
CDS:
805..1224

Additional Resources:

NCBI RefSeq record:
NM_001310658.1
NBCI Gene record:
Vwc2l (320460)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310658.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177549 CAGTAATGACAATCTGATCTT pLKO.1 918 CDS 100% 4.950 6.930 N Vwc2l n/a
2 TRCN0000178511 CCGAAATGTACAAAGGTGGAA pLKO.1 1087 CDS 100% 2.640 3.696 N Vwc2l n/a
3 TRCN0000177868 CTTTGATGACTATCGAGGGAA pLKO.1 936 CDS 100% 2.640 3.696 N Vwc2l n/a
4 TRCN0000215382 CTAGACCCTTCTCTATTATTA pLKO.1 3710 3UTR 100% 15.000 10.500 N Vwc2l n/a
5 TRCN0000177958 GAAGACTATCCTGCTGATGAA pLKO.1 883 CDS 100% 4.950 3.465 N Vwc2l n/a
6 TRCN0000182409 GCCATCAGTCACGAAGACTAT pLKO.1 871 CDS 100% 4.950 3.465 N Vwc2l n/a
7 TRCN0000182720 CACGAAGACTATCCTGCTGAT pLKO.1 880 CDS 100% 4.050 2.835 N Vwc2l n/a
8 TRCN0000177750 CAAAGGTGGAACACAATGGAT pLKO.1 1097 CDS 100% 3.000 2.100 N Vwc2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310658.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05652 pDONR223 100% 58.5% 58.5% None (many diffs) n/a
2 ccsbBroad304_05652 pLX_304 0% 58.5% 58.5% V5 (many diffs) n/a
3 TRCN0000475702 AACACTTCCATCGGCATTTGCATA pLX_317 51.8% 58.5% 58.5% V5 (many diffs) n/a
Download CSV