Transcript: Mouse XM_006496064.2

PREDICTED: Mus musculus von Willebrand factor C domain-containing protein 2-like (Vwc2l), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vwc2l (320460)
Length:
2824
CDS:
1299..1829

Additional Resources:

NCBI RefSeq record:
XM_006496064.2
NBCI Gene record:
Vwc2l (320460)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496064.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177549 CAGTAATGACAATCTGATCTT pLKO.1 1412 CDS 100% 4.950 6.930 N Vwc2l n/a
2 TRCN0000178511 CCGAAATGTACAAAGGTGGAA pLKO.1 1581 CDS 100% 2.640 3.696 N Vwc2l n/a
3 TRCN0000177868 CTTTGATGACTATCGAGGGAA pLKO.1 1430 CDS 100% 2.640 3.696 N Vwc2l n/a
4 TRCN0000177958 GAAGACTATCCTGCTGATGAA pLKO.1 1377 CDS 100% 4.950 3.465 N Vwc2l n/a
5 TRCN0000182409 GCCATCAGTCACGAAGACTAT pLKO.1 1365 CDS 100% 4.950 3.465 N Vwc2l n/a
6 TRCN0000182720 CACGAAGACTATCCTGCTGAT pLKO.1 1374 CDS 100% 4.050 2.835 N Vwc2l n/a
7 TRCN0000177750 CAAAGGTGGAACACAATGGAT pLKO.1 1591 CDS 100% 3.000 2.100 N Vwc2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496064.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05652 pDONR223 100% 74.7% 77% None (many diffs) n/a
2 ccsbBroad304_05652 pLX_304 0% 74.7% 77% V5 (many diffs) n/a
3 TRCN0000475702 AACACTTCCATCGGCATTTGCATA pLX_317 51.8% 74.7% 77% V5 (many diffs) n/a
Download CSV