Transcript: Human NM_001345929.2

Homo sapiens von Willebrand factor C domain containing 2 like (VWC2L), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-11-21
Taxon:
Homo sapiens (human)
Gene:
VWC2L (402117)
Length:
4508
CDS:
814..1233

Additional Resources:

NCBI RefSeq record:
NM_001345929.2
NBCI Gene record:
VWC2L (402117)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001345929.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255391 TTGCAGGAACGACGATAATTC pLKO_005 1216 CDS 100% 13.200 18.480 N VWC2L n/a
2 TRCN0000255390 TACAAGTTGGGAGAACGATTT pLKO_005 994 CDS 100% 10.800 15.120 N VWC2L n/a
3 TRCN0000281405 GGTGACCAGATCTCCAGTAAT pLKO_005 913 CDS 100% 13.200 9.240 N VWC2L n/a
4 TRCN0000255392 GACCAACCAGAATGCCCTAAA pLKO_005 1069 CDS 100% 10.800 7.560 N VWC2L n/a
5 TRCN0000255389 TTCACCCAAAGTGTACTAAAG pLKO_005 1091 CDS 100% 10.800 7.560 N VWC2L n/a
6 TRCN0000177549 CAGTAATGACAATCTGATCTT pLKO.1 927 CDS 100% 4.950 3.465 N Vwc2l n/a
7 TRCN0000177958 GAAGACTATCCTGCTGATGAA pLKO.1 892 CDS 100% 4.950 3.465 N Vwc2l n/a
8 TRCN0000177868 CTTTGATGACTATCGAGGGAA pLKO.1 945 CDS 100% 2.640 1.848 N Vwc2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001345929.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05652 pDONR223 100% 62.6% 59% None 389_390ins130;417_418ins119 n/a
2 ccsbBroad304_05652 pLX_304 0% 62.6% 59% V5 389_390ins130;417_418ins119 n/a
3 TRCN0000475702 AACACTTCCATCGGCATTTGCATA pLX_317 51.8% 62.6% 59% V5 389_390ins130;417_418ins119 n/a
Download CSV