Transcript: Human XM_006711552.3

PREDICTED: Homo sapiens progestin and adipoQ receptor family member 6 (PAQR6), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAQR6 (79957)
Length:
1654
CDS:
168..1208

Additional Resources:

NCBI RefSeq record:
XM_006711552.3
NBCI Gene record:
PAQR6 (79957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711552.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060845 GCTGGGAACCTACTCATTATT pLKO.1 824 CDS 100% 15.000 12.000 N PAQR6 n/a
2 TRCN0000262465 CAGTTTGCCAGCAGCTATTTG pLKO_005 1412 3UTR 100% 13.200 9.240 N PAQR6 n/a
3 TRCN0000262467 TGGCACCAGGACGCTTTGATT pLKO_005 568 CDS 100% 5.625 3.938 N PAQR6 n/a
4 TRCN0000262468 ATGCGTGTCCAGGCTGAAGAT pLKO_005 1192 CDS 100% 4.950 3.465 N PAQR6 n/a
5 TRCN0000060843 CCTACTCATTATTGCTGCTTT pLKO.1 832 CDS 100% 4.950 3.465 N PAQR6 n/a
6 TRCN0000262464 CTCTTGATGGGAGTGGAAGAA pLKO_005 1144 CDS 100% 4.950 3.465 N PAQR6 n/a
7 TRCN0000060846 GCTGACGAGGAGCCCAGATTT pLKO.1 990 CDS 100% 4.400 3.080 N PAQR6 n/a
8 TRCN0000262466 CATCTCAGCCTGGAACCAACA pLKO_005 1032 CDS 100% 4.050 2.835 N PAQR6 n/a
9 TRCN0000060844 CTTCGCCTATCCATTCCTGTT pLKO.1 398 CDS 100% 4.050 2.835 N PAQR6 n/a
10 TRCN0000060847 CACCAGTTATTCCACATCTGT pLKO.1 674 CDS 100% 3.000 2.100 N PAQR6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711552.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04151 pDONR223 100% 50.9% 34.5% None 178_179ins333;427_497del;771_1038del n/a
2 ccsbBroad304_04151 pLX_304 0% 50.9% 34.5% V5 178_179ins333;427_497del;771_1038del n/a
3 TRCN0000475775 TGTCACAGTGGTTACAGCCTGAAA pLX_317 30.1% 50.9% 34.5% V5 178_179ins333;427_497del;771_1038del n/a
Download CSV