Transcript: Human NM_007270.5

Homo sapiens FKBP prolyl isomerase 9 (FKBP9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
FKBP9 (11328)
Length:
3424
CDS:
135..1847

Additional Resources:

NCBI RefSeq record:
NM_007270.5
NBCI Gene record:
FKBP9 (11328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007270.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054191 CGAGAGACGTTTCGTGAAGAT pLKO.1 446 CDS 100% 4.950 6.930 N FKBP9 n/a
2 TRCN0000291344 CGAGAGACGTTTCGTGAAGAT pLKO_005 446 CDS 100% 4.950 6.930 N FKBP9 n/a
3 TRCN0000054192 GACTCCACTTTCAATGTGTTT pLKO.1 366 CDS 100% 4.950 3.465 N FKBP9 n/a
4 TRCN0000291347 GACTCCACTTTCAATGTGTTT pLKO_005 366 CDS 100% 4.950 3.465 N FKBP9 n/a
5 TRCN0000054189 GCCTACGGAAATGAAGGAGTT pLKO.1 480 CDS 100% 4.050 2.430 N FKBP9 n/a
6 TRCN0000291345 GCCTACGGAAATGAAGGAGTT pLKO_005 480 CDS 100% 4.050 2.430 N FKBP9 n/a
7 TRCN0000054190 GCTGAGTAAGAAGGGAGATTA pLKO.1 1286 CDS 100% 13.200 6.600 Y FKBP9 n/a
8 TRCN0000291309 GCTGAGTAAGAAGGGAGATTA pLKO_005 1286 CDS 100% 13.200 6.600 Y FKBP9 n/a
9 TRCN0000054188 CGCACGTTTGACACGTACATT pLKO.1 1041 CDS 100% 5.625 2.813 Y FKBP9 n/a
10 TRCN0000291346 CGCACGTTTGACACGTACATT pLKO_005 1041 CDS 100% 5.625 2.813 Y FKBP9 n/a
11 TRCN0000056319 GCTGAGCTGATTGTGAAGAAT pLKO.1 1734 CDS 100% 5.625 2.813 Y FKBP9P1 n/a
12 TRCN0000056322 GCTGATTGTGAAGAATATGTT pLKO.1 1739 CDS 100% 5.625 2.813 Y FKBP9P1 n/a
13 TRCN0000056320 CCTGGAAGAGTTCTCAGAGTA pLKO.1 1661 CDS 100% 4.950 2.475 Y FKBP9P1 n/a
14 TRCN0000056318 GCCGTATTAGTGTTTGACATT pLKO.1 1527 CDS 100% 4.950 2.475 Y FKBP9P1 n/a
15 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 2864 3UTR 100% 1.080 0.540 Y GPR83 n/a
16 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 2864 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007270.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02673 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02673 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476251 AAATTTCCCTTGACGTACATGCCT pLX_317 14% 100% 100% V5 n/a
4 ccsbBroadEn_10361 pDONR223 100% 24.6% 24.7% None (many diffs) n/a
5 ccsbBroad304_10361 pLX_304 0% 24.6% 24.7% V5 (many diffs) n/a
6 TRCN0000481194 CGTATCACACTTGGGGCGCCTTTT pLX_317 83.6% 24.6% 24.7% V5 (many diffs) n/a
Download CSV