Transcript: Human NR_027340.1

Homo sapiens FKBP prolyl isomerase 9 pseudogene 1 (FKBP9P1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-11-04
Taxon:
Homo sapiens (human)
Gene:
FKBP9P1 (360132)
Length:
2190
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027340.1
NBCI Gene record:
FKBP9P1 (360132)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027340.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056321 GCTGAGGAATTTAAACTCAAA pLKO.1 545 3UTR 100% 4.950 2.970 N FKBP9P1 n/a
2 TRCN0000056319 GCTGAGCTGATTGTGAAGAAT pLKO.1 482 3UTR 100% 5.625 2.813 Y FKBP9P1 n/a
3 TRCN0000056322 GCTGATTGTGAAGAATATGTT pLKO.1 487 3UTR 100% 5.625 2.813 Y FKBP9P1 n/a
4 TRCN0000056320 CCTGGAAGAGTTCTCAGAGTA pLKO.1 409 3UTR 100% 4.950 2.475 Y FKBP9P1 n/a
5 TRCN0000056318 GCCGTATTAGTGTTTGACATT pLKO.1 275 3UTR 100% 4.950 2.475 Y FKBP9P1 n/a
6 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1610 3UTR 100% 1.080 0.540 Y GPR83 n/a
7 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1610 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027340.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10361 pDONR223 100% 19.4% None 1_166del;593_2190del n/a
2 ccsbBroad304_10361 pLX_304 0% 19.4% V5 1_166del;593_2190del n/a
3 TRCN0000481194 CGTATCACACTTGGGGCGCCTTTT pLX_317 83.6% 19.4% V5 1_166del;593_2190del n/a
4 ccsbBroadEn_02673 pDONR223 100% 16.7% None (many diffs) n/a
5 ccsbBroad304_02673 pLX_304 0% 16.7% V5 (many diffs) n/a
6 TRCN0000476251 AAATTTCCCTTGACGTACATGCCT pLX_317 14% 16.7% V5 (many diffs) n/a
Download CSV