Transcript: Mouse NM_012056.2

Mus musculus FK506 binding protein 9 (Fkbp9), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fkbp9 (27055)
Length:
3011
CDS:
149..1861

Additional Resources:

NCBI RefSeq record:
NM_012056.2
NBCI Gene record:
Fkbp9 (27055)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_012056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111851 CCCAAGGATACCATTTCCATT pLKO.1 914 CDS 100% 4.950 6.930 N Fkbp9 n/a
2 TRCN0000332876 CCCAAGGATACCATTTCCATT pLKO_005 914 CDS 100% 4.950 6.930 N Fkbp9 n/a
3 TRCN0000111852 CCTACGGAAGTGAAGGAGTTT pLKO.1 495 CDS 100% 4.950 6.930 N Fkbp9 n/a
4 TRCN0000332800 CCTACGGAAGTGAAGGAGTTT pLKO_005 495 CDS 100% 4.950 6.930 N Fkbp9 n/a
5 TRCN0000111853 CCACACCTTTGACACATACAT pLKO.1 1054 CDS 100% 5.625 3.938 N Fkbp9 n/a
6 TRCN0000332806 CCACACCTTTGACACATACAT pLKO_005 1054 CDS 100% 5.625 3.938 N Fkbp9 n/a
7 TRCN0000111850 CCAGGTGTCTACCTAAAGAAA pLKO.1 2206 3UTR 100% 5.625 3.938 N Fkbp9 n/a
8 TRCN0000332801 CCAGGTGTCTACCTAAAGAAA pLKO_005 2206 3UTR 100% 5.625 3.938 N Fkbp9 n/a
9 TRCN0000111854 CATCAGCATCACTTCCCACTA pLKO.1 1258 CDS 100% 4.050 2.835 N Fkbp9 n/a
10 TRCN0000332879 CATCAGCATCACTTCCCACTA pLKO_005 1258 CDS 100% 4.050 2.835 N Fkbp9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02673 pDONR223 100% 88% 92.8% None (many diffs) n/a
2 ccsbBroad304_02673 pLX_304 0% 88% 92.8% V5 (many diffs) n/a
3 TRCN0000476251 AAATTTCCCTTGACGTACATGCCT pLX_317 14% 88% 92.8% V5 (many diffs) n/a
4 ccsbBroadEn_10361 pDONR223 100% 22.4% 23.8% None (many diffs) n/a
5 ccsbBroad304_10361 pLX_304 0% 22.4% 23.8% V5 (many diffs) n/a
6 TRCN0000481194 CGTATCACACTTGGGGCGCCTTTT pLX_317 83.6% 22.4% 23.8% V5 (many diffs) n/a
Download CSV