Construct: ORF TRCN0000476544
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013083.1_s317c1
- Derived from:
- ccsbBroadEn_15355
- DNA Barcode:
- TAAAAGAACTTAAAGTAATACTGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ANXA8L2 (244)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476544
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 728113 | ANXA8L1 | annexin A8 like 1 | NM_001278924.2 | 100% | 100% | |
| 2 | human | 728113 | ANXA8L1 | annexin A8 like 1 | NM_001278923.2 | 77.2% | 77.2% | 111_112ins114;475_570del |
| 3 | human | 653145 | ANXA8 | annexin A8 | NM_001271702.1 | 75.1% | 75% | (many diffs) |
| 4 | human | 728113 | ANXA8L1 | annexin A8 like 1 | NM_001098845.3 | 65.2% | 65.2% | 111_112ins114;320_490del;646_741del |
| 5 | human | 653145 | ANXA8 | annexin A8 | NM_001040084.3 | 64.7% | 64.6% | (many diffs) |
| 6 | human | 653145 | ANXA8 | annexin A8 | XM_006717951.3 | 60.8% | 60.9% | (many diffs) |
| 7 | human | 653145 | ANXA8 | annexin A8 | XM_011540098.1 | 52% | 51.9% | (many diffs) |
| 8 | human | 653145 | ANXA8 | annexin A8 | NM_001271703.1 | 46.7% | 46.5% | (many diffs) |
| 9 | human | 653145 | ANXA8 | annexin A8 | XM_011540101.2 | 32.4% | 30.4% | (many diffs) |
| 10 | mouse | 11752 | Anxa8 | annexin A8 | NM_001281845.1 | 58.7% | 57.6% | (many diffs) |
| 11 | mouse | 11752 | Anxa8 | annexin A8 | NM_013473.4 | 57.3% | 58.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 894
- ORF length:
- 828
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ctggtggaaa gcctggattg aacaggaggg tgtcacagtg aagagcagct 121 cccacttcaa cccagaccct gatgcagaga ccctctacaa agccatgaag gggatcggtg 181 tcgggtccca actgctcagc caccaagcag ctgccttcgc cttcccctcc tccgccctca 241 ccagtgtgtc accctggggg cagcagggtc acttgtgctg taaccctgca gggaccaacg 301 agcaggctat catcgatgtg ctcaccaaga gaagcaacac gcagcggcag cagatcgcca 361 agtccttcaa ggctcagttc ggcaaggacc tcactgagac cttgaagtct gagctcagtg 421 gcaagtttga gaggctcatt gtggccctta tgtatccgcc atacagatac gaagccaagg 481 agctgcatga cgccatgaag ggcagcaggg atgatgtgag cagctttgtg gacccggcac 541 tggcccTCCA AGACGCACAG GATCTGTATG CGGCAGGCGA GAAGATTCGT GGGACTGATG 601 AGATGAAATT CATCACCATC CTGTGCACGC GCAGTGCCAC TCACCTGCTG AGAGTGAAAT 661 GCACCCAAAA CCTCCACAGC TACTTTGCAG AGAGACTCTA CTATGCCATG AAGGGAGCAG 721 GGACGCGTGA TGGGACCCTG ATAAGAAACA TCGTTTCAAG GAGCGAGATT GACTTAAATC 781 TTATCAAATG TCACTTCAAG AAGATGTACG GCAAGACCCT CAGCAGCATG ATCATGGAAG 841 ACACCAGCGG CGACTACAAG AACGCCCTGC TGAGCCTGGT GGGCAGCGAC CCCTGCCCAA 901 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 961 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1021 TATCTTGTGG AAAGGACGAT AAAAGAACTT AAAGTAATAC TGAACGCGTT AAGTCgacaa 1081 tcaacctctg gattacaaaa tttgtgaaag att