Transcript: Human NM_001040084.3

Homo sapiens annexin A8 (ANXA8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ANXA8 (653145)
Length:
2020
CDS:
183..1166

Additional Resources:

NCBI RefSeq record:
NM_001040084.3
NBCI Gene record:
ANXA8 (653145)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256102 ATGTACCCGCCATACAGATAC pLKO_005 453 CDS 100% 10.800 6.480 N ANXA8L1 n/a
2 TRCN0000256101 AGGAGCGAGATTGACTTAAAT pLKO_005 1029 CDS 100% 15.000 7.500 Y ANXA8L1 n/a
3 TRCN0000256103 AGAACCAGCTGCGGGAGATAA pLKO_005 556 CDS 100% 13.200 6.600 Y ANXA8L1 n/a
4 TRCN0000424332 AGCCTTTCGGTCTTCTATTTC pLKO_005 1265 3UTR 100% 13.200 6.600 Y ANXA8L1 n/a
5 TRCN0000262791 CAAGGAGCGAGATTGACTTAA pLKO_005 1027 CDS 100% 13.200 6.600 Y ANXA8 n/a
6 TRCN0000262794 GAACCAGCTGCGGGAGATAAT pLKO_005 557 CDS 100% 13.200 6.600 Y ANXA8 n/a
7 TRCN0000256100 GTCTCCTGGGCACAGGTTATA pLKO_005 1497 3UTR 100% 13.200 6.600 Y ANXA8L1 n/a
8 TRCN0000262795 TCTCCTGGGCACAGGTTATAC pLKO_005 1498 3UTR 100% 13.200 6.600 Y ANXA8 n/a
9 TRCN0000262793 TGGGACTGATGAGATGAAATT pLKO_005 764 CDS 100% 13.200 6.600 Y ANXA8 n/a
10 TRCN0000262792 AGGCGTATGAGGAAGACTATG pLKO_005 580 CDS 100% 10.800 5.400 Y ANXA8 n/a
11 TRCN0000437273 AGGCTCATTGTGGCCCTTATG pLKO_005 435 CDS 100% 10.800 5.400 Y ANXA8L1 n/a
12 TRCN0000256104 TTGCAGAGAGACTCTACTATG pLKO_005 955 CDS 100% 10.800 5.400 Y ANXA8L1 n/a
13 TRCN0000055945 CGTGGGACTGATGAGATGAAA pLKO.1 762 CDS 100% 5.625 2.813 Y ANXA8L1 n/a
14 TRCN0000055944 CCCTGATAAGAAACATCGTTT pLKO.1 1006 CDS 100% 4.950 2.475 Y ANXA8L1 n/a
15 TRCN0000055947 GACCCTCTACAAAGCCATGAA pLKO.1 266 CDS 100% 4.950 2.475 Y ANXA8L1 n/a
16 TRCN0000055943 CGGGAGATAATGAAGGCGTAT pLKO.1 567 CDS 100% 4.050 2.025 Y ANXA8L1 n/a
17 TRCN0000055946 GCGAGATTGACTTAAATCTTA pLKO.1 1033 CDS 100% 0.563 0.281 Y ANXA8L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05724 pDONR223 98.6% 100% 100% None n/a
2 ccsbBroad304_05724 pLX_304 0% 100% 100% V5 (not translated due to prior stop codon) n/a
3 ccsbBroadEn_15355 pDONR223 0% 64.7% 64.6% None (many diffs) n/a
4 ccsbBroad304_15355 pLX_304 0% 64.7% 64.6% V5 (many diffs) n/a
5 TRCN0000476544 TAAAAGAACTTAAAGTAATACTGA pLX_317 42.2% 64.7% 64.6% V5 (many diffs) n/a
Download CSV