Transcript: Mouse NM_013473.4

Mus musculus annexin A8 (Anxa8), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Anxa8 (11752)
Length:
1892
CDS:
78..1061

Additional Resources:

NCBI RefSeq record:
NM_013473.4
NBCI Gene record:
Anxa8 (11752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013473.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110713 AGGAGTGAGATTGACTTAAAT pLKO.1 924 CDS 100% 15.000 21.000 N Anxa8 n/a
2 TRCN0000335009 AGGAGTGAGATTGACTTAAAT pLKO_005 924 CDS 100% 15.000 21.000 N Anxa8 n/a
3 TRCN0000110712 CGTGAAGGGTAGTTCTCATTT pLKO.1 119 CDS 100% 13.200 18.480 N Anxa8 n/a
4 TRCN0000363775 CGTGAAGGGTAGTTCTCATTT pLKO_005 119 CDS 100% 13.200 18.480 N Anxa8 n/a
5 TRCN0000110711 CGCTGATAAGGAACATTGTTT pLKO.1 901 CDS 100% 5.625 7.875 N Anxa8 n/a
6 TRCN0000110710 CCATCCTAATAGCACGCATTA pLKO.1 1638 3UTR 100% 10.800 8.640 N Anxa8 n/a
7 TRCN0000110714 GAGAAGATTATGGGAACCGAT pLKO.1 648 CDS 100% 2.640 2.112 N Anxa8 n/a
8 TRCN0000335008 GAGAAGATTATGGGAACCGAT pLKO_005 648 CDS 100% 2.640 2.112 N Anxa8 n/a
9 TRCN0000055947 GACCCTCTACAAAGCCATGAA pLKO.1 161 CDS 100% 4.950 2.970 N ANXA8L1 n/a
10 TRCN0000256104 TTGCAGAGAGACTCTACTATG pLKO_005 850 CDS 100% 10.800 7.560 N ANXA8L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013473.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05724 pDONR223 98.6% 88.7% 92% None (many diffs) n/a
2 ccsbBroad304_05724 pLX_304 0% 88.7% 92% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_15355 pDONR223 0% 57.3% 58.9% None (many diffs) n/a
4 ccsbBroad304_15355 pLX_304 0% 57.3% 58.9% V5 (many diffs) n/a
5 TRCN0000476544 TAAAAGAACTTAAAGTAATACTGA pLX_317 42.2% 57.3% 58.9% V5 (many diffs) n/a
Download CSV