Construct: ORF TRCN0000476867
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002925.1_s317c1
- Derived from:
- ccsbBroadEn_13899
- DNA Barcode:
- ATTCCTAATTTTTGTCTTACCCCC
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MPP3 (4356)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476867
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4356 | MPP3 | membrane palmitoylated prot... | NM_001932.5 | 99.9% | 99.4% | 1746delT |
2 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_006721915.2 | 99.9% | 99.4% | 1746delT |
3 | human | 4356 | MPP3 | membrane palmitoylated prot... | NM_001353080.1 | 98.5% | 98.1% | 223_246del;1770delT |
4 | human | 4356 | MPP3 | membrane palmitoylated prot... | NM_001330233.1 | 95.8% | 95.4% | 1_75del;1821delT |
5 | human | 4356 | MPP3 | membrane palmitoylated prot... | XR_001752516.1 | 76% | (many diffs) | |
6 | human | 4356 | MPP3 | membrane palmitoylated prot... | XR_002958011.1 | 75.9% | (many diffs) | |
7 | human | 4356 | MPP3 | membrane palmitoylated prot... | XR_001752517.2 | 72% | (many diffs) | |
8 | human | 4356 | MPP3 | membrane palmitoylated prot... | XR_934466.2 | 71.8% | (many diffs) | |
9 | human | 4356 | MPP3 | membrane palmitoylated prot... | XR_001752512.2 | 71.6% | (many diffs) | |
10 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_017024656.1 | 65.3% | 64.7% | 1_1delAins607;1140delT |
11 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_017024657.2 | 60.6% | 60.1% | 0_1ins690;1056delT |
12 | human | 4356 | MPP3 | membrane palmitoylated prot... | NR_003562.3 | 60.4% | (many diffs) | |
13 | human | 4356 | MPP3 | membrane palmitoylated prot... | XR_001752515.1 | 59.5% | 1_339del;1348_1629del;2035_2036ins340 | |
14 | human | 4356 | MPP3 | membrane palmitoylated prot... | NR_148343.1 | 59% | (many diffs) | |
15 | human | 4356 | MPP3 | membrane palmitoylated prot... | NR_148342.1 | 56% | (many diffs) | |
16 | human | 4356 | MPP3 | membrane palmitoylated prot... | NR_148344.1 | 54.3% | (many diffs) | |
17 | human | 4356 | MPP3 | membrane palmitoylated prot... | NR_148345.1 | 53.8% | (many diffs) | |
18 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_017024658.1 | 51.6% | 51.6% | 1_75del;1020_1021ins809 |
19 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_006721916.3 | 48.5% | 39.7% | (many diffs) |
20 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_017024659.1 | 48.4% | 48.3% | (many diffs) |
21 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_017024655.1 | 48.2% | 39.2% | 1_75del;683_815del;1155_1156ins807 |
22 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_017024660.1 | 35% | 35% | (many diffs) |
23 | mouse | 13384 | Mpp3 | membrane protein, palmitoyl... | NM_007863.2 | 87.3% | 90.4% | (many diffs) |
24 | mouse | 13384 | Mpp3 | membrane protein, palmitoyl... | XM_006532138.3 | 87.3% | 90.4% | (many diffs) |
25 | mouse | 13384 | Mpp3 | membrane protein, palmitoyl... | XM_006532139.3 | 77% | 78.9% | (many diffs) |
26 | mouse | 13384 | Mpp3 | membrane protein, palmitoyl... | XM_006532140.3 | 47.7% | 51.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1821
- ORF length:
- 1755
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc agtgctatcg gaggactctg gtttgcatga aaccctggcc ctgctgacct 121 cccagctcag acctgactcc aaccacaagg aggagatggg cttcctgagg gatgttttca 181 gtgaaaaaag cctcagttac ttaatgaaga ttcatgagaa gcttcgctat tatgaaaggc 241 aaagtccaac cccagttctg cacagcgctg tggccctcgc tgaggacgtg atggaggagt 301 tgcaggccgc ctccgtgcac agtgatgaga gggagctgct ccagctgctg tccaccccgc 361 acctgagggc tgtgctcatg gtacatgaca cggttgccca gaagaatttt gaccccgttc 421 tcccgcctct gcctgacaat atcgatgagg attttgatga ggaatcggtg aagatcgtcc 481 gcttggtgaa gaacaaggaa cccctgggtg ccaccatccg gcgggacgag cactcagggg 541 ctgttgtggt ggccaggatc atgcgaggag gcgcagcaga caggagcggc ctggtccacg 601 ttggagatga gctccgagaa gtgaacggga tcgcagtcct gcacaagcgg cccgacgaga 661 tcagccagat tctggcccag tcccagggat ccatcaccct aaaaatcatc ccagccaccc 721 aggaggaaga tcgcttaaag gagagcaagg tgttcatgcg cgccctcttc cactacaacc 781 ctcgggagga ccgggccatc ccttgccagg aggcgggcct gcccttccag cgcaggcagg 841 tcctggaggt ggtgagccag gacgacccca cgtggtggca ggccaagcga gtcggggaca 901 ccaaccttcg agccggcctc atcccctcca aggggttcca ggagagacga ctaagctacc 961 ggagagccgc gggcaccctg ccgagccccc agagcctcag gaagcccccc tatgatcagc 1021 cttgtgacaa agagacctgt gactgtgagg gctacctcaa agggcactat gtggctggtc 1081 ttcggaggag cttccggctg ggctgtaggg agagactggg tggctcgcag gaaggaaaga 1141 tgtcctccgg agctgagtct ccggagctgc tgacttacga agaggtggcc aggtaccaac 1201 accagcccgg agagcggccc cgcctggtgg ttctgatcgg gtctctggga gcccgactgc 1261 acgagctgaa gcaaaaggtg gtggctgaga acccacagca ctttggcgtc gctgttccac 1321 ataccaccag gccccgaaag agccatgaga aggaaggagt ggaatatcac tttgtgtcta 1381 agcaagcatt tgaggccgac ttacatcaca acaagttCCT GGAACATGGT GAATATAAGG 1441 AAAATCTGTA TGGAACCAGC CTGGAGGCCA TTCAGGCTGT TATGGCCAAA AACAAAGTTT 1501 GTTTGGTGGA TGTGGAGCCA GAAGCACTGA AACAACTGAG GACCTCAGAA TTTAAACCCT 1561 ATATTATATT TGTAAAGCCT GCAATTCAGG AAAAAAGAAA AACGCCACCT ATGTCCCCAG 1621 CTTGTGAGGA CACAGCAGCC CCATTTGATG AGCAGCAGCA AGAGATGGCC GCTTCTGCCG 1681 CCTTCATAGA CCGGCATTAC GGGCACCTGG TAGACGCCGT GCTGGTGAAG GAGGATCTCC 1741 AGGGTGCCTA CAGCCAGCTC AAAGTGGTCT TAGAGAAGCT GAGCAAGGAC ACTCACTGGG 1801 TACCTGTTAG TGGGTCAGGT ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC 1861 TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA 1921 AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAATTCC TAATTTTTGT 1981 CTTACCCCCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg tgaaagatt