Transcript: Human NR_003562.3

Homo sapiens membrane palmitoylated protein 3 (MPP3), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
MPP3 (4356)
Length:
2845
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003562.3
NBCI Gene record:
MPP3 (4356)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235631 CGCCTTCATAGACCGGCATTA pLKO_005 1783 3UTR 100% 10.800 15.120 N MPP3 n/a
2 TRCN0000006134 CCTGACAATATCGATGAGGAT pLKO.1 557 3UTR 100% 2.640 3.696 N MPP3 n/a
3 TRCN0000356501 GTTCCAGGAGAGACGACTAAG pLKO_005 1060 3UTR 100% 10.800 8.640 N MPP3 n/a
4 TRCN0000006131 CCTTTCTAAATACCCTCAGAT pLKO.1 2580 3UTR 100% 4.950 3.960 N MPP3 n/a
5 TRCN0000356504 CATGAGAAGCTTCGCTATTAT pLKO_005 338 3UTR 100% 15.000 10.500 N MPP3 n/a
6 TRCN0000235629 CAGGAGGAAGATCGCTTAAAG pLKO_005 845 3UTR 100% 13.200 9.240 N MPP3 n/a
7 TRCN0000235630 GAAGTGCTTGCCTGGTAATAG pLKO_005 2408 3UTR 100% 13.200 9.240 N MPP3 n/a
8 TRCN0000235632 TAGTTGGGTCAGGTAACTTTA pLKO_005 1912 3UTR 100% 13.200 9.240 N MPP3 n/a
9 TRCN0000006135 CAAGCATTTGAGGCCGACTTA pLKO.1 1487 3UTR 100% 4.950 3.465 N MPP3 n/a
10 TRCN0000006132 CCTCAGTTACTTAATGAAGAT pLKO.1 316 3UTR 100% 4.950 3.465 N MPP3 n/a
11 TRCN0000006133 CCATTTGATGAGCAGCAGCAA pLKO.1 1745 3UTR 100% 2.640 1.848 N MPP3 n/a
12 TRCN0000356575 CCAGGGATCCATCACCCTAAA pLKO_005 808 3UTR 100% 10.800 6.480 N MPP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13899 pDONR223 100% 60.4% None (many diffs) n/a
2 ccsbBroad304_13899 pLX_304 0% 60.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000476867 ATTCCTAATTTTTGTCTTACCCCC pLX_317 23.2% 60.4% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_14702 pDONR223 92.8% 60% None (many diffs) n/a
5 ccsbBroad304_14702 pLX_304 0% 60% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000479442 CTCCCCGACTCACATGTCCGATAG pLX_317 16.2% 60% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV