Transcript: Mouse XM_006532138.3

PREDICTED: Mus musculus membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) (Mpp3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mpp3 (13384)
Length:
2979
CDS:
331..2088

Additional Resources:

NCBI RefSeq record:
XM_006532138.3
NBCI Gene record:
Mpp3 (13384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532138.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231388 CATGAGAAACTCCGCTATTAT pLKO_005 478 CDS 100% 15.000 21.000 N Mpp3 n/a
2 TRCN0000024295 CCAGACGAGATCAGCCAAATT pLKO.1 916 CDS 100% 13.200 18.480 N Mpp3 n/a
3 TRCN0000231389 CCAGACGAGATCAGCCAAATT pLKO_005 916 CDS 100% 13.200 18.480 N Mpp3 n/a
4 TRCN0000231392 GAATAGCGTGTTGTTCATTAA pLKO_005 2304 3UTR 100% 13.200 18.480 N Mpp3 n/a
5 TRCN0000024296 GCCCTATGTTATATTTGTGAA pLKO.1 1821 CDS 100% 4.950 6.930 N Mpp3 n/a
6 TRCN0000361118 CCTGGAGCATGGAGAATATAA pLKO_005 1683 CDS 100% 15.000 10.500 N Mpp3 n/a
7 TRCN0000361113 TGAGAAGAGCCTCAGTTATTT pLKO_005 447 CDS 100% 15.000 10.500 N Mpp3 n/a
8 TRCN0000361173 GGGTACTTTAAAGGACATTAT pLKO_005 1315 CDS 100% 13.200 9.240 N Mpp3 n/a
9 TRCN0000231390 CCCAATCCCAGGGATCCATTA pLKO_005 941 CDS 100% 10.800 7.560 N Mpp3 n/a
10 TRCN0000024294 GCCTTCATAGATCAGCACTAT pLKO.1 1945 CDS 100% 4.950 3.465 N Mpp3 n/a
11 TRCN0000024297 CCCGATAACATCGATGAGGAT pLKO.1 697 CDS 100% 2.640 1.848 N Mpp3 n/a
12 TRCN0000361171 TACCATGATGTTTCAGCTTTA pLKO_005 2417 3UTR 100% 0.000 0.000 N Mpp3 n/a
13 TRCN0000231391 GTTTAAGCCCTATGTTATATT pLKO_005 1815 CDS 100% 15.000 9.000 N Mpp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532138.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13899 pDONR223 100% 87.3% 90.4% None (many diffs) n/a
2 ccsbBroad304_13899 pLX_304 0% 87.3% 90.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000476867 ATTCCTAATTTTTGTCTTACCCCC pLX_317 23.2% 87.3% 90.4% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_14702 pDONR223 92.8% 85.1% 48.6% None (many diffs) n/a
5 ccsbBroad304_14702 pLX_304 0% 85.1% 48.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000479442 CTCCCCGACTCACATGTCCGATAG pLX_317 16.2% 85.1% 48.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV