Construct: ORF TRCN0000476868
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018471.1_s317c1
- Derived from:
- ccsbBroadEn_08326
- DNA Barcode:
- TGCGATGGTCCAAGTCACGTCTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIGT (51604)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476868
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51604 | PIGT | phosphatidylinositol glycan... | NM_015937.6 | 99.8% | 100% | 1371G>A;1620T>C |
2 | human | 51604 | PIGT | phosphatidylinositol glycan... | NM_001184728.3 | 90.1% | 90.3% | 324_325ins168;1203G>A;1452T>C |
3 | human | 51604 | PIGT | phosphatidylinositol glycan... | NM_001184729.3 | 88.2% | 88.2% | 1033_1034ins201;1170G>A;1419T>C |
4 | human | 51604 | PIGT | phosphatidylinositol glycan... | NM_001184730.3 | 82.2% | 82.3% | 186_187ins306;1065G>A;1314T>C |
5 | human | 51604 | PIGT | phosphatidylinositol glycan... | NR_047691.2 | 78% | (many diffs) | |
6 | human | 51604 | PIGT | phosphatidylinositol glycan... | NR_047693.2 | 75.2% | (many diffs) | |
7 | human | 51604 | PIGT | phosphatidylinositol glycan... | NR_047692.2 | 72.9% | (many diffs) | |
8 | human | 51604 | PIGT | phosphatidylinositol glycan... | NR_047694.2 | 71.6% | (many diffs) | |
9 | human | 51604 | PIGT | phosphatidylinositol glycan... | NR_047695.2 | 61.1% | (many diffs) | |
10 | mouse | 78928 | Pigt | phosphatidylinositol glycan... | NM_133779.2 | 87% | 93.4% | (many diffs) |
11 | mouse | 78928 | Pigt | phosphatidylinositol glycan... | XM_006500421.3 | 87% | 93.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1800
- ORF length:
- 1734
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcggctatg ccgcttgctc tgctcgtcct gttgctcctg gggcccggcg 121 gctggtgcct tgcagaaccc ccacgcgaca gcctgcggga ggaacttgtc atcaccccgc 181 tgccttccgg ggacgtagcc gccacattcc agttccgcac gcgctgggat tcggagcttc 241 agcgggaagg agtgtcccat tacaggctct ttcccaaagc cctggggcag ctgatctcca 301 agtattctct acgggagctg cacctgtcat tcacacaagg cttttggagg acccgatact 361 gggggccacc cttcctgcag gccccatcag gtgcagagct gtgggtctgg ttccaagaca 421 ctgtcactga tgtggataaa tcttggaagg agctcagtaa tgtcctctca gggatcttct 481 gcgcctctct caacttcatc gactccacca acacagtcac tcccactgcc tccttcaaac 541 ccctgggtct ggccaatgac actgaccact actttctgcg ctatgctgtg ctgccgcggg 601 aggtggtctg caccgaaaac ctcaccccct ggaagaagct cttgccctgt agttccaagg 661 caggcctctc tgtgctgctg aaggcagatc gcttgttcca caccagctac cactcccagg 721 cagtgcatat ccgccctgtt tgcagaaatg cacgctgtac tagcatctcc tgggagctga 781 ggcagaccct gtcagttgta tttgatgcct tcatcacggg gcagggaaag aaagactggt 841 ccctcttccg gatgttctcc cgaaccctca cggagccctg ccccctggct tcagagagcc 901 gagtctatgt ggacatcacc acctacaacc aggacaacga gacattagag gtgcacccac 961 ccccgaccac tacatatcag gacgtcatcc taggcactcg gaagacctat gccatctatg 1021 acttgcttga caccgccatg atcaacaact ctcgaaacct caacatccag ctcaagtgga 1081 agagaccccc agagaatgag gcccccccag tgcccttcct gcatgcccag cggtacgtga 1141 gtggctatgg gctgcagaag ggggagctga gcacactgct gtacaacacc cacccatacc 1201 gggccttccc ggtgctgctg ctggacaccg taccctggta tctgcggctg tatgtgcaca 1261 ccctcaccat cacctccaag ggcaaggaga acaaaccaag ttacatccac taccagcctg 1321 cccaggaccg gctgcaaccc cacctcctgg agatgctgat tcagctgccg gccaactcag 1381 tcaccaaggt ttccatccag tttgagcggg cgctgctgaa gtggaccgag tacacaccag 1441 atcctaacca tggcttctat gtcagcccat ctgtcctcag cgcccttgtg cccagcatgg 1501 tagcagccaa gccagtggac tgggaagaga gtcccctctt caacagcctg ttcccagtct 1561 cTGATGGCTC TAACTACTTT GTGCGGCTCT ACACGGAGCC GCTGCTGGTG AACCTGCCGA 1621 CACCGGACTT CAGCATGCCC TACAACGTGA TCTGCCTCAC GTGCACTGTG GTGGCCGTGT 1681 GCTACGGCTC CTTCTACAAT CTCCTCACCC GAACCTTCCA CATCGAGGAG CCCCGCACAG 1741 GTGGCCTGGC CAAGCGGCTG GCCAACCTTA TCCGGCGCGC CCGAGGTGTC CCCCCACTCT 1801 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1861 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1921 TTTATATATC TTGTGGAAAG GACGATGCGA TGGTCCAAGT CACGTCTCGA CGCGTTAAGT 1981 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt