Transcript: Human NR_047695.2

Homo sapiens phosphatidylinositol glycan anchor biosynthesis class T (PIGT), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PIGT (51604)
Length:
1761
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_047695.2
NBCI Gene record:
PIGT (51604)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_047695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141139 CACGAGCCAAATGTGGCATTT pLKO.1 1501 3UTR 100% 10.800 15.120 N PIGT n/a
2 TRCN0000141070 CGGAAGACCTATGCCATCTAT pLKO.1 543 3UTR 100% 5.625 7.875 N PIGT n/a
3 TRCN0000141797 GCAGACCCTGTCAGTTGTATT pLKO.1 326 3UTR 100% 13.200 9.240 N PIGT n/a
4 TRCN0000280840 GCAGACCCTGTCAGTTGTATT pLKO_005 326 3UTR 100% 13.200 9.240 N PIGT n/a
5 TRCN0000144421 CAAGGAGAACAAACCAAGTTA pLKO.1 827 3UTR 100% 5.625 3.938 N PIGT n/a
6 TRCN0000144499 CAAACCAAGTTACATCCACTA pLKO.1 836 3UTR 100% 4.050 2.835 N PIGT n/a
7 TRCN0000122663 GCAGAAATGCACGCTGTACTA pLKO.1 286 3UTR 100% 4.950 2.970 N PIGT n/a
8 TRCN0000280768 GCAGAAATGCACGCTGTACTA pLKO_005 286 3UTR 100% 4.950 2.970 N PIGT n/a
9 TRCN0000142054 GCTGTATTGGACAGCACAGAA pLKO.1 1611 3UTR 100% 0.495 0.297 N PIGT n/a
10 TRCN0000143693 GAGCCAAATGTGGCATTTGAA pLKO.1 1504 3UTR 100% 0.563 0.281 Y PIGT n/a
11 TRCN0000280842 GAGCCAAATGTGGCATTTGAA pLKO_005 1504 3UTR 100% 0.563 0.281 Y PIGT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_047695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08326 pDONR223 100% 61.1% None (many diffs) n/a
2 ccsbBroad304_08326 pLX_304 0% 61.1% V5 (many diffs) n/a
3 TRCN0000476868 TGCGATGGTCCAAGTCACGTCTCG pLX_317 14.1% 61.1% V5 (many diffs) n/a
Download CSV