Transcript: Mouse XM_006499290.1

PREDICTED: Mus musculus spermine oxidase (Smox), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smox (228608)
Length:
2324
CDS:
280..1878

Additional Resources:

NCBI RefSeq record:
XM_006499290.1
NBCI Gene record:
Smox (228608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421960 TTTATCCGCCAGAGCGCTATG pLKO_005 1520 CDS 100% 6.000 8.400 N Smox n/a
2 TRCN0000076714 CGGCATGGTAAACCAGTCAAT pLKO.1 742 CDS 100% 4.950 6.930 N Smox n/a
3 TRCN0000429221 AGAAGGTGCGGAATCGCATCA pLKO_005 800 CDS 100% 4.050 5.670 N Smox n/a
4 TRCN0000076715 CCTATCTATCAACTAGCAGAA pLKO.1 541 CDS 100% 4.050 5.670 N Smox n/a
5 TRCN0000045980 CGATTTATACAACGAGGTCTA pLKO.1 699 CDS 100% 4.050 5.670 N SMOX n/a
6 TRCN0000076713 CCGTGCTCTTAATTTCCTAAT pLKO.1 2106 3UTR 100% 10.800 8.640 N Smox n/a
7 TRCN0000076717 ACCACGTGATTGTGACCGTTT pLKO.1 1256 CDS 100% 4.050 3.240 N Smox n/a
8 TRCN0000359567 ATTTATACAACGAGGTCTATA pLKO_005 701 CDS 100% 13.200 9.240 N SMOX n/a
9 TRCN0000421741 ATTTATACAACGAGGTCTATA pLKO_005 701 CDS 100% 13.200 9.240 N Smox n/a
10 TRCN0000442182 CACAGAGATGCTTCGACAGTT pLKO_005 1623 CDS 100% 4.950 3.465 N Smox n/a
11 TRCN0000427086 CCACACACCGCAAGTACTACT pLKO_005 1923 3UTR 100% 4.950 3.465 N Smox n/a
12 TRCN0000413980 TAGTCGTGGAGTGCGAGGATT pLKO_005 1217 CDS 100% 4.950 3.465 N Smox n/a
13 TRCN0000076716 CCTTGAATTTGAGGAGCCCTT pLKO.1 1386 CDS 100% 2.160 1.512 N Smox n/a
14 TRCN0000416073 AGGTGTCCTCACTGCCAAATG pLKO_005 2034 3UTR 100% 10.800 6.480 N Smox n/a
15 TRCN0000438586 CTTTGGAGAATGGACGGAGAT pLKO_005 942 CDS 100% 4.050 2.430 N Smox n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08385 pDONR223 99.1% 75.6% 79.4% None (many diffs) n/a
2 ccsbBroad304_08385 pLX_304 0% 75.6% 79.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_08386 pDONR223 100% 75.6% 79.4% None (many diffs) n/a
4 ccsbBroad304_08386 pLX_304 0% 75.6% 79.4% V5 (many diffs) n/a
5 TRCN0000476984 CTGTCCATAGCTTCTTATCGACTG pLX_317 22% 75.6% 79.4% V5 (many diffs) n/a
Download CSV