Transcript: Human NM_175840.3

Homo sapiens spermine oxidase (SMOX), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SMOX (54498)
Length:
2005
CDS:
177..1685

Additional Resources:

NCBI RefSeq record:
NM_175840.3
NBCI Gene record:
SMOX (54498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359566 CCCATGGGAACCCTATCTATC pLKO_005 427 CDS 100% 10.800 8.640 N SMOX n/a
2 TRCN0000045978 CGGCACGATAAACCAGTCAAT pLKO.1 639 CDS 100% 4.950 3.960 N SMOX n/a
3 TRCN0000359567 ATTTATACAACGAGGTCTATA pLKO_005 598 CDS 100% 13.200 9.240 N SMOX n/a
4 TRCN0000421741 ATTTATACAACGAGGTCTATA pLKO_005 598 CDS 100% 13.200 9.240 N Smox n/a
5 TRCN0000359635 CCACCCACCGCAAGTACTATT pLKO_005 1576 CDS 100% 13.200 9.240 N SMOX n/a
6 TRCN0000359634 GAGTTCTTCCGGCACGATAAA pLKO_005 630 CDS 100% 13.200 9.240 N SMOX n/a
7 TRCN0000045982 GAGTGCAACAGCCTACAGTTT pLKO.1 1155 CDS 100% 4.950 3.465 N SMOX n/a
8 TRCN0000045979 CCTATCTATCATCTAGCAGAA pLKO.1 438 CDS 100% 4.050 2.835 N SMOX n/a
9 TRCN0000045980 CGATTTATACAACGAGGTCTA pLKO.1 596 CDS 100% 4.050 2.835 N SMOX n/a
10 TRCN0000045981 CCTCATTGAGATGTACCGAGA pLKO.1 1643 CDS 100% 2.160 1.512 N SMOX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08385 pDONR223 99.1% 99.8% 100% None 1017A>G;1353A>G n/a
2 ccsbBroad304_08385 pLX_304 0% 99.8% 100% V5 (not translated due to prior stop codon) 1017A>G;1353A>G n/a
3 ccsbBroadEn_08386 pDONR223 100% 99.8% 100% None 1017A>G;1353A>G n/a
4 ccsbBroad304_08386 pLX_304 0% 99.8% 100% V5 1017A>G;1353A>G n/a
5 TRCN0000476984 CTGTCCATAGCTTCTTATCGACTG pLX_317 22% 99.8% 100% V5 1017A>G;1353A>G n/a
Download CSV