Construct: ORF TRCN0000477104
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004874.1_s317c1
- Derived from:
- ccsbBroadEn_06495
- DNA Barcode:
- TTGCGAATGTCGGCCTCGTCGGGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KLRC2 (3822)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477104
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 3822 | KLRC2 | killer cell lectin like rec... | NM_002260.3 | 99.7% | 99.1% | 5A>G;305T>C |
2 | human | 3823 | KLRC3 | killer cell lectin like rec... | NM_002261.2 | 91.2% | 86.6% | (many diffs) |
3 | human | 3821 | KLRC1 | killer cell lectin like rec... | NM_213658.2 | 87.1% | 76.9% | (many diffs) |
4 | human | 3821 | KLRC1 | killer cell lectin like rec... | NM_002259.5 | 87% | 76.4% | (many diffs) |
5 | human | 3823 | KLRC3 | killer cell lectin like rec... | NM_007333.2 | 85.9% | 81.7% | (many diffs) |
6 | human | 3821 | KLRC1 | killer cell lectin like rec... | NM_001304448.1 | 85% | 74.7% | (many diffs) |
7 | human | 3821 | KLRC1 | killer cell lectin like rec... | XM_024448973.1 | 84.9% | 74.3% | (many diffs) |
8 | human | 3821 | KLRC1 | killer cell lectin like rec... | NM_213657.2 | 82.8% | 73.1% | (many diffs) |
9 | human | 3821 | KLRC1 | killer cell lectin like rec... | NM_007328.4 | 82.6% | 72.7% | (many diffs) |
10 | human | 8302 | KLRC4 | killer cell lectin like rec... | NM_013431.2 | 61.6% | 51.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 762
- ORF length:
- 693
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagtaaacaa agaggaacct tctcagaagt gagtctggcc caggacccaa 121 agcggcagca aaggaaacct aaaggcaata aaagctccat ttcaggaacc gaacaggaaa 181 tattccaagt agaattaaat cttcaaaatc cttccctgaa tcatcaaggg attgataaaa 241 tatatgactg ccaaggttta ctgccacctc cagagaagct cactgccgag gtcctaggaa 301 tcatttgcat tgtcctgatg gccactgtgt taaaaacaat agttcttatt cctttcctgg 361 agcagaacaa ttcttccccg aatacaagaa cgcagaaagc acgtcattgt ggccattgtc 421 cTGAGGAGTG GATTACATAT TCCAACAGTT GTTATTACAT TGGTAAGGAA AGAAGAACTT 481 GGGAAGAGAG TTTGCTGGCC TGTACTTCGA AGAACTCCAG TCTGCTTTCT ATAGATAATG 541 AAGAAGAAAT GAAATTTCTG GCCAGCATTT TACCTTCCTC ATGGATTGGT GTGTTTCGTA 601 ACAGCAGTCA TCATCCATGG GTGACAATAA ATGGTTTGGC TTTCAAACAT AAGATAAAAG 661 ACTCAGATAA TGCTGAACTT AACTGTGCAG TGCTACAAGT AAATCGACTT AAATCAGCCC 721 AGTGTGGATC TTCAATGATA TATCATTGTA AGCATAAGCT TTTGCCAACT TTCTTGTACA 781 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 841 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 901 AGGACGATTG CGAATGTCGG CCTCGTCGGG GACGCGTTAA GTCgacaatc aacctctgga 961 ttacaaaatt tgtgaaagat t