Transcript: Human NM_002260.3

Homo sapiens killer cell lectin like receptor C2 (KLRC2), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
KLRC2 (3822)
Length:
1223
CDS:
8..703

Additional Resources:

NCBI RefSeq record:
NM_002260.3
NBCI Gene record:
KLRC2 (3822)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002260.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424052 GAAGTAAAGCATTTGCGTTTG pLKO_005 703 CDS 100% 6.000 4.200 N KLRC2 n/a
2 TRCN0000431178 ATGACCACTAATTGATAGAAC pLKO_005 1043 3UTR 100% 4.950 3.465 N KLRC2 n/a
3 TRCN0000057399 CCCGAATACAAGAACGCAGAA pLKO.1 316 CDS 100% 4.050 2.835 N KLRC3 n/a
4 TRCN0000057404 CGGCAGCAAAGGAAACCTAAA pLKO.1 62 CDS 100% 10.800 6.480 N KLRC2 n/a
5 TRCN0000057405 CCAGTGTGGATCTTCAATGAT pLKO.1 658 CDS 100% 5.625 3.375 N KLRC2 n/a
6 TRCN0000420994 GATGCACACAATTACTAAAGT pLKO_005 841 3UTR 100% 5.625 3.375 N KLRC2 n/a
7 TRCN0000425779 TGCGTTTGCAGTGCATCAGAT pLKO_005 716 3UTR 100% 4.950 2.970 N KLRC2 n/a
8 TRCN0000057406 CCGAGGTCCTAGGAATCATTT pLKO.1 225 CDS 100% 13.200 6.600 Y KLRC2 n/a
9 TRCN0000057403 GCTACAAGTAAATCGACTTAA pLKO.1 631 CDS 100% 13.200 6.600 Y KLRC2 n/a
10 TRCN0000057407 CCAGTCTGCTTTCTATAGATA pLKO.1 456 CDS 100% 5.625 2.813 Y KLRC2 n/a
11 TRCN0000428920 AGTCAGCTTATAGGAAGTACC pLKO_005 949 3UTR 100% 4.050 2.025 Y KLRC2 n/a
12 TRCN0000057348 GCATGTTATGTGAGTCAGCTT pLKO.1 937 3UTR 100% 2.640 1.320 Y KLRC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002260.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06495 pDONR223 100% 99.7% 99.1% None 5A>G;305T>C n/a
2 ccsbBroad304_06495 pLX_304 0% 99.7% 99.1% V5 5A>G;305T>C n/a
3 TRCN0000477104 TTGCGAATGTCGGCCTCGTCGGGG pLX_317 49% 99.7% 99.1% V5 5A>G;305T>C n/a
4 ccsbBroadEn_00910 pDONR223 100% 87.1% 76.4% None (many diffs) n/a
5 ccsbBroad304_00910 pLX_304 0% 87.1% 76.4% V5 (many diffs) n/a
6 TRCN0000471458 AGCTCAATCAACTCAACCTTACAA pLX_317 48.8% 87.1% 76.4% V5 (many diffs) n/a
7 ccsbBroadEn_06494 pDONR223 100% 82.8% 72.7% None (many diffs) n/a
8 ccsbBroad304_06494 pLX_304 0% 82.8% 72.7% V5 (many diffs) n/a
9 TRCN0000472306 ACCGACGGTGTTGTACGCAGAAAC pLX_317 78.6% 82.8% 72.7% V5 (many diffs) n/a
10 ccsbBroadEn_01885 pDONR223 100% 61.9% 52.4% None (many diffs) n/a
11 ccsbBroad304_01885 pLX_304 0% 61.9% 52.4% V5 (many diffs) n/a
12 TRCN0000468522 CCTTTCGCCTAAACGATCGCGTCT pLX_317 71% 61.9% 52.4% V5 (many diffs) n/a
Download CSV