Transcript: Human XM_024448973.1

PREDICTED: Homo sapiens killer cell lectin like receptor C1 (KLRC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLRC1 (3821)
Length:
1818
CDS:
506..1192

Additional Resources:

NCBI RefSeq record:
XM_024448973.1
NBCI Gene record:
KLRC1 (3821)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413222 GAAATAACCTATGCGGAATTA pLKO_005 614 CDS 100% 13.200 18.480 N KLRC1 n/a
2 TRCN0000436977 TGGCCTCTGTGGTAACGATAG pLKO_005 756 CDS 100% 6.000 8.400 N KLRC1 n/a
3 TRCN0000057352 GCTCCAGAGAAGCTCATTGTT pLKO.1 704 CDS 100% 5.625 3.938 N KLRC1 n/a
4 TRCN0000057350 CCATCATTTCACCATCCTCAT pLKO.1 1005 CDS 100% 4.050 2.835 N KLRC1 n/a
5 TRCN0000057351 CGATAGTTGTTATTCCCTCTA pLKO.1 771 CDS 100% 4.050 2.835 N KLRC1 n/a
6 TRCN0000057349 CCTGGGAATTATCTGTCTTAT pLKO.1 730 CDS 100% 13.200 7.920 N KLRC1 n/a
7 TRCN0000057403 GCTACAAGTAAATCGACTTAA pLKO.1 1135 CDS 100% 13.200 6.600 Y KLRC2 n/a
8 TRCN0000057407 CCAGTCTGCTTTCTATAGATA pLKO.1 960 CDS 100% 5.625 2.813 Y KLRC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00910 pDONR223 100% 97.7% 97.4% None 86A>G;684_685insTGTAAGCATAAGCTT n/a
2 ccsbBroad304_00910 pLX_304 0% 97.7% 97.4% V5 86A>G;684_685insTGTAAGCATAAGCTT n/a
3 TRCN0000471458 AGCTCAATCAACTCAACCTTACAA pLX_317 48.8% 97.7% 97.4% V5 86A>G;684_685insTGTAAGCATAAGCTT n/a
4 ccsbBroadEn_06494 pDONR223 100% 89.8% 89.2% None (many diffs) n/a
5 ccsbBroad304_06494 pLX_304 0% 89.8% 89.2% V5 (many diffs) n/a
6 TRCN0000472306 ACCGACGGTGTTGTACGCAGAAAC pLX_317 78.6% 89.8% 89.2% V5 (many diffs) n/a
7 ccsbBroadEn_06495 pDONR223 100% 84.9% 74.3% None (many diffs) n/a
8 ccsbBroad304_06495 pLX_304 0% 84.9% 74.3% V5 (many diffs) n/a
9 TRCN0000477104 TTGCGAATGTCGGCCTCGTCGGGG pLX_317 49% 84.9% 74.3% V5 (many diffs) n/a
Download CSV