Transcript: Human NM_002261.2

Homo sapiens killer cell lectin like receptor C3 (KLRC3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
KLRC3 (3823)
Length:
1042
CDS:
46..768

Additional Resources:

NCBI RefSeq record:
NM_002261.2
NBCI Gene record:
KLRC3 (3823)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002261.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430602 GAGTGCTCATGTACCATTTAG pLKO_005 835 3UTR 100% 13.200 18.480 N KLRC3 n/a
2 TRCN0000414754 TGGATCTTCAAGAATCATTAG pLKO_005 705 CDS 100% 10.800 7.560 N KLRC3 n/a
3 TRCN0000057402 GTGGACTTATATCAGACCAGT pLKO.1 683 CDS 100% 2.640 1.848 N KLRC3 n/a
4 TRCN0000057406 CCGAGGTCCTAGGAATCATTT pLKO.1 263 CDS 100% 13.200 6.600 Y KLRC2 n/a
5 TRCN0000057398 CCTCCCAAGTTGCTGGGATTA pLKO.1 793 3UTR 100% 1.080 0.540 Y KLRC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002261.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06495 pDONR223 100% 91.2% 86.6% None (many diffs) n/a
2 ccsbBroad304_06495 pLX_304 0% 91.2% 86.6% V5 (many diffs) n/a
3 TRCN0000477104 TTGCGAATGTCGGCCTCGTCGGGG pLX_317 49% 91.2% 86.6% V5 (many diffs) n/a
4 ccsbBroadEn_00910 pDONR223 100% 80.4% 66.6% None (many diffs) n/a
5 ccsbBroad304_00910 pLX_304 0% 80.4% 66.6% V5 (many diffs) n/a
6 TRCN0000471458 AGCTCAATCAACTCAACCTTACAA pLX_317 48.8% 80.4% 66.6% V5 (many diffs) n/a
7 ccsbBroadEn_06494 pDONR223 100% 76.2% 62.9% None (many diffs) n/a
8 ccsbBroad304_06494 pLX_304 0% 76.2% 62.9% V5 (many diffs) n/a
9 TRCN0000472306 ACCGACGGTGTTGTACGCAGAAAC pLX_317 78.6% 76.2% 62.9% V5 (many diffs) n/a
10 ccsbBroadEn_01885 pDONR223 100% 59.2% 52.6% None (many diffs) n/a
11 ccsbBroad304_01885 pLX_304 0% 59.2% 52.6% V5 (many diffs) n/a
12 TRCN0000468522 CCTTTCGCCTAAACGATCGCGTCT pLX_317 71% 59.2% 52.6% V5 (many diffs) n/a
Download CSV