Transcript: Mouse NM_139309.4

Mus musculus fukutin (Fktn), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Fktn (246179)
Length:
3382
CDS:
113..1498

Additional Resources:

NCBI RefSeq record:
NM_139309.4
NBCI Gene record:
Fktn (246179)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139309.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193660 CAACTATGGTAAGACCTGGAA pLKO.1 1375 CDS 100% 2.640 3.696 N Fktn n/a
2 TRCN0000350236 CAACTATGGTAAGACCTGGAA pLKO_005 1375 CDS 100% 2.640 3.696 N Fktn n/a
3 TRCN0000432583 AGTTACAGTTTGGTCGTTATC pLKO_005 723 CDS 100% 10.800 8.640 N FKTN n/a
4 TRCN0000174300 CGGTATTATTCCTTACAGCAA pLKO.1 1039 CDS 100% 2.640 2.112 N Fktn n/a
5 TRCN0000314334 CGGTATTATTCCTTACAGCAA pLKO_005 1039 CDS 100% 2.640 2.112 N Fktn n/a
6 TRCN0000194045 GCAGTGGTACTTGCTGATAAA pLKO.1 2196 3UTR 100% 13.200 9.240 N Fktn n/a
7 TRCN0000314335 GCAGTGGTACTTGCTGATAAA pLKO_005 2196 3UTR 100% 13.200 9.240 N Fktn n/a
8 TRCN0000175490 CCTTGGAATGTGTAGTCACTA pLKO.1 2837 3UTR 100% 4.950 3.465 N Fktn n/a
9 TRCN0000314265 CCTTGGAATGTGTAGTCACTA pLKO_005 2837 3UTR 100% 4.950 3.465 N Fktn n/a
10 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 2989 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139309.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00547 pDONR223 100% 87.5% 89.8% None (many diffs) n/a
2 ccsbBroad304_00547 pLX_304 0% 87.5% 89.8% V5 (many diffs) n/a
3 TRCN0000477168 TATCTTTCCCAATCGAGACGCCGT pLX_317 23.3% 87.5% 89.8% V5 (many diffs) n/a
Download CSV