Construct: ORF TRCN0000477527
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007685.1_s317c1
- Derived from:
- ccsbBroadEn_02021
- DNA Barcode:
- TGTAACCGATCCCACACATCGTGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDKL1 (8814)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477527
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8814 | CDKL1 | cyclin dependent kinase like 1 | NM_004196.5 | 100% | 100% | |
| 2 | human | 8814 | CDKL1 | cyclin dependent kinase like 1 | XM_005268157.3 | 100% | 100% | |
| 3 | human | 8814 | CDKL1 | cyclin dependent kinase like 1 | XM_011537276.1 | 85.4% | 84.3% | (many diffs) |
| 4 | human | 8814 | CDKL1 | cyclin dependent kinase like 1 | NM_001367064.1 | 84% | 84% | 795_796ins171 |
| 5 | human | 8814 | CDKL1 | cyclin dependent kinase like 1 | NM_001367065.1 | 84% | 84% | 795_796ins171 |
| 6 | human | 8814 | CDKL1 | cyclin dependent kinase like 1 | XM_017021730.1 | 84% | 84% | 795_796ins171 |
| 7 | human | 8814 | CDKL1 | cyclin dependent kinase like 1 | XM_017021732.1 | 76.9% | 74.8% | (many diffs) |
| 8 | human | 8814 | CDKL1 | cyclin dependent kinase like 1 | NM_001282236.2 | 76.2% | 74.6% | (many diffs) |
| 9 | human | 8814 | CDKL1 | cyclin dependent kinase like 1 | XM_005268160.4 | 67.2% | 66.2% | (many diffs) |
| 10 | human | 8814 | CDKL1 | cyclin dependent kinase like 1 | XR_943549.2 | 53.4% | 1_640del;1606_1870del;1962_1963insACCGTTTTCCAAACATT | |
| 11 | human | 8814 | CDKL1 | cyclin dependent kinase like 1 | XR_001750577.2 | 39.2% | (many diffs) | |
| 12 | mouse | 71091 | Cdkl1 | cyclin-dependent kinase-lik... | NM_183294.2 | 84.4% | 88.5% | (many diffs) |
| 13 | mouse | 71091 | Cdkl1 | cyclin-dependent kinase-lik... | XM_017315202.1 | 84.4% | 88.5% | (many diffs) |
| 14 | mouse | 71091 | Cdkl1 | cyclin-dependent kinase-lik... | XM_017315203.1 | 84.4% | 88.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1143
- ORF length:
- 1074
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gatggagaag tatgaaaaaa ttgggaaaat tggagaagga tcctatggag 121 ttgttttcaa atgtagaaac agggacacgg gtcagattgt ggccatcaag aagtttctgg 181 aatcagaaga tgaccctgtc ataaagaaaa ttgcccttcg ggaaatccga atgctcaagc 241 aactcaagca tcccaacctt gttaacctcc tggaagtctt caggaggaaa cggaggcttc 301 acctggtgtt tgaatattgt gaccacacag ttctccatga gttggacaga taccaaagag 361 gggtaccaga acatctcgtg aagagcataa cttggcagac actgcaagct gtaaattttt 421 gccataaaca caattgcata catagagacg tgaagccaga aaatatcctc atcacgaaac 481 attccgtgat taagctttgt gactttggat ttgctcggct tttgactgga ccgagtgact 541 actatacaga ctacgtggct accaggtggt accgctcccc tgagctgctg gtgggggaca 601 cgcagtacgg ccccccggtg gatgtttggg caattggctg tgtctttgct gagctgctgt 661 caggagtgcc tctgtggcca ggaaaatcgg atgtggatca gctgtatctg attaggaaga 721 ccttggggga tctcattcct aggcaccagc aagtgtttag cacgaatcag tacttCAGTG 781 GAGTGAAAAT TCCAGACCCT GAAGATATGG AACCACTTGA ATTAAAATTC CCAAACATCT 841 CTTATCCTGC CCTGGGGCTC CTAAAGGGCT GTCTCCACAT GGACCCTACT CAAAGGCTGA 901 CATGTGAACA GCTGTTGCAT CACCCATATT TTGAAAACAT CAGAGAAATA GAGGATTTGG 961 CAAAAGAACA CAACAAACCA ACAAGGAAGA CCCTAAGAAA GAGCCGAAAG CACCACTGCT 1021 TTACAGAAAC ATCCAAGTTG CAGTACCTAC CCCAGCTAAC TGGCAGCAGC ATCCTTCCAG 1081 CTTTGGATAA TAAGAAGTAC TACTGTGATA CCAAGAAACT TAACTACCGT TTTCCAAACA 1141 TTTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1201 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1261 GGCTTTATAT ATCTTGTGGA AAGGACGATG TAACCGATCC CACACATCGT GGACGCGTTA 1321 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt