Transcript: Human XR_001750577.2

PREDICTED: Homo sapiens cyclin dependent kinase like 1 (CDKL1), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDKL1 (8814)
Length:
2739
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001750577.2
NBCI Gene record:
CDKL1 (8814)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001750577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356033 GCTGTTGCATCACCCATATTT pLKO_005 1570 3UTR 100% 15.000 21.000 N CDKL1 n/a
2 TRCN0000006071 CACGAAACATTCCGTGATTAA pLKO.1 1045 3UTR 100% 13.200 18.480 N CDKL1 n/a
3 TRCN0000356032 CTGGACCGAGTGACTACTATA pLKO_005 1098 3UTR 100% 13.200 18.480 N CDKL1 n/a
4 TRCN0000006073 CCGGTGGATGTTTGGGCAATT pLKO.1 1187 3UTR 100% 10.800 15.120 N CDKL1 n/a
5 TRCN0000356034 CCACATGGACCCTACTCAAAG pLKO_005 1534 3UTR 100% 10.800 8.640 N CDKL1 n/a
6 TRCN0000355982 ACGAAACATTCCGTGATTAAG pLKO_005 1046 3UTR 100% 13.200 9.240 N CDKL1 n/a
7 TRCN0000195639 CCTACTCAAAGGCTGACATGT pLKO.1 1544 3UTR 100% 4.950 3.465 N CDKL1 n/a
8 TRCN0000197130 GTCAGATTGTGGCCATCAAGA pLKO.1 723 3UTR 100% 4.950 3.465 N CDKL1 n/a
9 TRCN0000006072 CCTGAAGATATGGAACCACTT pLKO.1 1370 3UTR 100% 4.050 2.835 N CDKL1 n/a
10 TRCN0000006069 CCAGCAAGTGTTTAGCACGAA pLKO.1 1318 3UTR 100% 2.640 1.848 N CDKL1 n/a
11 TRCN0000006070 GCCATCAAGAAGTTTCTGGAA pLKO.1 734 3UTR 100% 2.640 1.848 N CDKL1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 567 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 567 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001750577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02021 pDONR223 100% 39.2% None (many diffs) n/a
2 ccsbBroad304_02021 pLX_304 0% 39.2% V5 (many diffs) n/a
3 TRCN0000477527 TGTAACCGATCCCACACATCGTGG pLX_317 34.4% 39.2% V5 (many diffs) n/a
4 TRCN0000470267 AATACCCGCGTAGATCGAACGGGA pLX_317 41.7% 32.7% V5 (many diffs) n/a
5 ccsbBroadEn_14914 pDONR223 100% 32.6% None (many diffs) n/a
6 ccsbBroad304_14914 pLX_304 0% 32.6% V5 (many diffs) n/a
Download CSV