Construct: ORF TRCN0000477624
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008869.1_s317c1
- Derived from:
- ccsbBroadEn_04446
- DNA Barcode:
- CTGAAATCTACATCCGATCTATAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AOPEP (84909)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477624
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 84909 | AOPEP | aminopeptidase O (putative) | NM_032823.5 | 100% | 100% | |
2 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_017015231.2 | 100% | 100% | |
3 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_005252284.3 | 92.5% | 88.2% | (many diffs) |
4 | human | 84909 | AOPEP | aminopeptidase O (putative) | NM_001193329.1 | 87.9% | 87.9% | 1363_1659del |
5 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_006717306.2 | 87.9% | 87.9% | 1363_1659del |
6 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_017015230.2 | 87.9% | 87.9% | 1363_1659del |
7 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_011519121.3 | 84.4% | 82.5% | (many diffs) |
8 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_011519119.2 | 81.9% | 78.2% | (many diffs) |
9 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_017015229.1 | 81.9% | 78.2% | (many diffs) |
10 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_011519120.3 | 77.4% | 73.7% | (many diffs) |
11 | human | 84909 | AOPEP | aminopeptidase O (putative) | XR_929853.2 | 75.8% | (many diffs) | |
12 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_017015232.2 | 74% | 73.9% | 1363_1659del;2116T>C;2118_2119ins339 |
13 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_011519123.3 | 73.9% | 73.9% | 1363_1659del;2115_2116ins342 |
14 | human | 84909 | AOPEP | aminopeptidase O (putative) | XR_001746404.2 | 73.9% | 1_218del;1791_1792ins44;2335_2819del | |
15 | human | 84909 | AOPEP | aminopeptidase O (putative) | XR_929854.2 | 73.4% | (many diffs) | |
16 | human | 84909 | AOPEP | aminopeptidase O (putative) | NM_001193331.3 | 72.9% | 65.8% | (many diffs) |
17 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_011519129.2 | 72.1% | 66.2% | (many diffs) |
18 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_011519122.3 | 71.5% | 67.8% | (many diffs) |
19 | human | 84909 | AOPEP | aminopeptidase O (putative) | XR_929857.2 | 68.2% | (many diffs) | |
20 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_011519130.2 | 66.1% | 62.8% | (many diffs) |
21 | human | 84909 | AOPEP | aminopeptidase O (putative) | XR_929852.2 | 64.4% | 1_218del;1581_1877del;2676_3350del | |
22 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_011519127.2 | 64.1% | 64.1% | 1363_1659del;1874C>A;1875_1876ins582 |
23 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_011519134.3 | 63.4% | 63% | 1365_1365delTinsACCCAGTAAAGACAA;1372_1375delTATTinsC;1377_1378ins772 |
24 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_017015237.2 | 58.7% | 55.6% | 0_1ins724;71_72ins167 |
25 | human | 84909 | AOPEP | aminopeptidase O (putative) | XR_929856.3 | 58.4% | (many diffs) | |
26 | human | 84909 | AOPEP | aminopeptidase O (putative) | XR_929855.2 | 54.4% | (many diffs) | |
27 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_017015236.2 | 53.6% | 46.9% | (many diffs) |
28 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_017015235.2 | 51.6% | 48.9% | 0_1ins724;71_72ins167;472_768del |
29 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_017015233.1 | 48.2% | 44.9% | (many diffs) |
30 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_017015234.2 | 47.4% | 41.6% | (many diffs) |
31 | human | 84909 | AOPEP | aminopeptidase O (putative) | XM_011519132.1 | 37.8% | 34.6% | (many diffs) |
32 | human | 84909 | AOPEP | aminopeptidase O (putative) | XR_001746402.2 | 32.9% | 1_218del;1581_1877del;2676_6560del | |
33 | human | 84909 | AOPEP | aminopeptidase O (putative) | XR_001746403.2 | 31% | 1_218del;1791_1792ins44;2335_6781del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2226
- ORF length:
- 2160
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga catacagctg gaccctgcca gagatgacct gcctctcatg gccaacacca 121 gccacatact tgtgaagcac tatgtactgg atttggatgt ggattttgaa agtcaagtca 181 ttgaggggac catagtgctt ttcctcgagg atggaaacag attcaagaaa cagaatagct 241 ctattgagga agcctgccaa tcagaatcaa acaaagcctg caaatttggg atgcctgaac 301 cctgccatat tcccgtgaca aatgcaagga ccttctcatc tgaaatggaa tataatgatt 361 ttgcaatctg tagtaaaggt gaaaaagata cttctgataa agatggtaac catgacaacc 421 aggaacatgc ttctgggatt tctagctcaa agtactgctg tgacacaggg aatcatggga 481 gtgaggattt tttgctagtg ttggactgct gtgatttatc tgtgttaaaa gtcgaggagg 541 tggatgttgc tgctgtgcca ggtctggaaa aatttacaag gtctcctgag ctcacggttg 601 tttctgagga gttcaggaat cagattgtac gtgaacttgt gactttgcct gcaaatcgtt 661 ggagggagca gttagactat tacgctcgct gcagccaggc tcctggctgt ggggaactcc 721 tctttgacac tgacacttgg agcttgcaga taaggaagac aggggctcag acagctactg 781 actttcctca tgctatcagg atatggtaca aaactaaacc tgaagggcga tcggttacat 841 ggacctcaga ccagagtggc aggccatgtg tttatactgt gggatctccc ataaacaaca 901 gggccctttt tccatgccag gagccacccg ttgccatgtc aacatggcag gctacagttc 961 gagcagctgc atcttttgtt gttttaatga gtggggaaaa ttctgccaaa ccaacgcagc 1021 tttgggaaga gtgctcaagc tggtattact atgtaactat gccaatgcca gcctccacct 1081 tcacaattgc agtgggatgc tggacagaaa tgaagatgga gacatggtca tcaaatgatt 1141 tggcaacaga gagacccttc tcaccttctg aggccaactt caggcatgtt ggtgtttgca 1201 gtcacatgga atacccctgc cgcttccaga atgcttctgc caccacccag gagatcattc 1261 ctcatcgggt ctttgcccct gtgtgcctca cgggtgcctg ccaagagacc cttctgcggc 1321 tgatccctcc ttgcctctca gcagcacatt ctgttctggg agcacacccg ttctctcggc 1381 tggatgttct catcgtccct gccaactttc caagtctggg gatggccaga cccagtaaag 1441 acaaaactgg ccacacaagt gactcgggag catctgttat caagcatgga cttaatccgg 1501 agaagatctt catgcaggtg cattatttaa agggctactt ccttcttcgg tttcttgcca 1561 aaagacttgg agatgaaacc tatttttcat ttttaagaaa atttgtgcac acatttcatg 1621 gacagctgat tctttcccag gatttccttc aaatgctact ggagaacatt ccagaagaaa 1681 aaaggcttga gctgtctgtt gaaaacatct accaagactg gcttgagagt tccggaatac 1741 caaagccgct gcagagggag cgtcgcgccg gggcggagtg cgggcttgcg cggcaagtgc 1801 gcgccgaggt cacgaaatgg attGGAGTGA ACCGGAGACC CCGAAAACGG AAGCGCAGGG 1861 AGAAGGAAGA GGTGTTTGAA AAGCTTCTTC CAGACCAGCT GGTCTTGCTT CTGGAGCATC 1921 TCTTGGAGCA GAAGACTCTG AGCCCCCGAA CTCTGCAAAG CCTCCAGAGG ACATACCACC 1981 TCCAGGATCA GGATGCAGAG GTTCGCCATC GGTGGTGTGA ACTCATTGTT AAGCACAAGT 2041 TCACGAAAGC CTACAAAAGT GTGGAGAGGT TCCTTCAGGA GGATCAGGCC ATGGGTGTGT 2101 ACCTCTACGG GGAGCTGATG GTGAGTGAGG ACGCCAGACA GCAGCAGCTC GCCCGTAGGT 2161 GCTTCGAGCG GACCAAGGAG CAGATGGATA GGTCCTCAGC CCAGGTGGTG GCCGAAATGT 2221 TATTTTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 2281 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 2341 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACTGAAATCT ACATCCGATC TATAAACGCG 2401 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt